\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407243554:

Variant ID: vg0407243554 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7243554
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAAGAGAGGAGAGAGAGGAGGAAATTAAAGATGAGGAAAAGGGAGGAGGAGTGGAGGAGAGGATAAGTGTGGAGGAGAGGATATACAGGGGGACCCAT[A/G]
GGTTCCCGGTATGCACTGGCATACCCATAAGTTTGAAAATTTTGCTAGGATCAGCTCTGCACCAGGAAGTCAGGAACTATGCAGGTGTATGCAGTATGCA

Reverse complement sequence

TGCATACTGCATACACCTGCATAGTTCCTGACTTCCTGGTGCAGAGCTGATCCTAGCAAAATTTTCAAACTTATGGGTATGCCAGTGCATACCGGGAACC[T/C]
ATGGGTCCCCCTGTATATCCTCTCCTCCACACTTATCCTCTCCTCCACTCCTCCTCCCTTTTCCTCATCTTTAATTTCCTCCTCTCTCTCCTCTCTTTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 33.00% 4.00% 15.26% NA
All Indica  2759 54.70% 17.90% 6.38% 21.02% NA
All Japonica  1512 35.10% 63.60% 0.33% 0.99% NA
Aus  269 56.50% 7.40% 1.12% 34.94% NA
Indica I  595 76.60% 12.10% 4.03% 7.23% NA
Indica II  465 27.70% 14.60% 9.03% 48.60% NA
Indica III  913 59.50% 21.40% 5.37% 13.80% NA
Indica Intermediate  786 48.50% 20.20% 7.76% 23.54% NA
Temperate Japonica  767 3.00% 96.60% 0.26% 0.13% NA
Tropical Japonica  504 87.50% 10.50% 0.20% 1.79% NA
Japonica Intermediate  241 27.80% 69.30% 0.83% 2.07% NA
VI/Aromatic  96 31.20% 52.10% 1.04% 15.62% NA
Intermediate  90 37.80% 38.90% 4.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407243554 A -> DEL N N silent_mutation Average:75.35; most accessible tissue: Callus, score: 99.465 N N N N
vg0407243554 A -> G LOC_Os04g13120.1 upstream_gene_variant ; 2666.0bp to feature; MODIFIER silent_mutation Average:75.35; most accessible tissue: Callus, score: 99.465 N N N N
vg0407243554 A -> G LOC_Os04g13130.1 downstream_gene_variant ; 4331.0bp to feature; MODIFIER silent_mutation Average:75.35; most accessible tissue: Callus, score: 99.465 N N N N
vg0407243554 A -> G LOC_Os04g13120-LOC_Os04g13130 intergenic_region ; MODIFIER silent_mutation Average:75.35; most accessible tissue: Callus, score: 99.465 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407243554 A G 0.05 0.02 0.0 0.04 0.06 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407243554 NA 1.89E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.04E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.23E-09 mr1093 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.11E-09 mr1251 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 2.52E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 3.43E-06 mr1285 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 2.30E-10 mr1435 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 4.16E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 3.51E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 2.20E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 8.90E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 5.64E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 2.93E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.34E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.60E-44 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.67E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 2.54E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 7.46E-11 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 5.89E-25 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 2.38E-13 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 1.50E-49 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 6.15E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407243554 NA 3.83E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251