Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407230816:

Variant ID: vg0407230816 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7230816
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCAACGGGGCCTGTGCCCAACTCAATGGCATTGGCAAGCGAATCGACGAGGCCTTGAAGCAAGAGTGTCGTCGAGCGAGCCGATATGCCGGAGGACAC[A/G]
TGCTGGCTTGCCTGCGAGATCACCGCCCGCGCTTGGATCTCGAATTTTTACGTGAAGGTTTTTTACATTCTCGGAGGAACCCGGCGGAGATAGATCACCT

Reverse complement sequence

AGGTGATCTATCTCCGCCGGGTTCCTCCGAGAATGTAAAAAACCTTCACGTAAAAATTCGAGATCCAAGCGCGGGCGGTGATCTCGCAGGCAAGCCAGCA[T/C]
GTGTCCTCCGGCATATCGGCTCGCTCGACGACACTCTTGCTTCAAGGCCTCGTCGATTCGCTTGCCAATGCCATTGAGTTGGGCACAGGCCCCGTTGAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.10%	19.90%	1.38%	0.55%	NA
All Indica	2759	99.20%	0.50%	0.22%	0.04%	NA
All Japonica	1512	36.90%	58.80%	2.91%	1.39%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.80%	1.50%	0.43%	0.22%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	99.00%	0.60%	0.38%	0.00%	NA
Temperate Japonica	767	3.90%	88.80%	4.95%	2.35%	NA
Tropical Japonica	504	90.30%	9.10%	0.40%	0.20%	NA
Japonica Intermediate	241	30.30%	67.20%	1.66%	0.83%	NA
VI/Aromatic	96	65.60%	20.80%	9.38%	4.17%	NA
Intermediate	90	72.20%	21.10%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407230816	A -> DEL	LOC_Os04g13100.1	N	frameshift_variant	Average:56.84; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	N	N	N	N
vg0407230816	A -> G	LOC_Os04g13100.1	missense_variant ; p.Met742Val; MODERATE	nonsynonymous_codon ; M742V	Average:56.84; most accessible tissue: Zhenshan97 flag leaf, score: 78.259	benign	-0.711	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407230816	NA	8.05E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.81E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	2.20E-11	mr1089	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	9.30E-43	mr1093	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	3.72E-11	mr1093	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	7.27E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.38E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	8.60E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.63E-15	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	8.58E-27	mr1423	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	9.03E-09	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	5.47E-12	mr1435	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	2.99E-10	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.03E-44	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.05E-07	mr1599	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	2.97E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	4.70E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	2.90E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	6.30E-17	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	4.11E-45	mr1771	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	2.08E-11	mr1790	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.67E-26	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.42E-06	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	9.65E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	3.40E-06	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	1.04E-07	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	5.60E-06	NA	mr1758_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407230816	NA	4.49E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251