\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407150917:

Variant ID: vg0407150917 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7150917
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTCTTATAAAAATGACAATTATTTTCAACCTGGAAGAAAATTATTTTGTTGTCAAAATAATTAATTTGAGTTTTTGTTGGTTCCCATACCTGTGGCCT[T/C]
GTGAGCAAGCACCTCCAGCTGGGGACAAAAGGGAACAATTAGTCCTCTCTTCCCACACTTCTCTCGAAGTTCTCGAGATAACTTGTGCTCCTCATTGGAC

Reverse complement sequence

GTCCAATGAGGAGCACAAGTTATCTCGAGAACTTCGAGAGAAGTGTGGGAAGAGAGGACTAATTGTTCCCTTTTGTCCCCAGCTGGAGGTGCTTGCTCAC[A/G]
AGGCCACAGGTATGGGAACCAACAAAAACTCAAATTAATTATTTTGACAACAAAATAATTTTCTTCCAGGTTGAAAATAATTGTCATTTTTATAAGACAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 40.70% 1.46% 6.03% NA
All Indica  2759 43.90% 47.90% 1.96% 6.23% NA
All Japonica  1512 63.20% 36.70% 0.00% 0.07% NA
Aus  269 55.80% 0.40% 5.20% 38.66% NA
Indica I  595 26.40% 73.30% 0.34% 0.00% NA
Indica II  465 54.20% 43.70% 1.29% 0.86% NA
Indica III  913 43.00% 37.60% 4.05% 15.33% NA
Indica Intermediate  786 52.20% 43.10% 1.15% 3.56% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 9.70% 90.10% 0.00% 0.20% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 15.60% 0.00% 6.25% NA
Intermediate  90 63.30% 33.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407150917 T -> C LOC_Os04g12950.1 missense_variant ; p.Lys324Glu; MODERATE nonsynonymous_codon ; K324E Average:63.922; most accessible tissue: Minghui63 young leaf, score: 81.195 benign 0.389 TOLERATED 0.43
vg0407150917 T -> DEL LOC_Os04g12950.1 N frameshift_variant Average:63.922; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407150917 T C -0.01 0.02 0.01 -0.01 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407150917 NA 3.69E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 4.89E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 3.07E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.34E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.11E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 4.82E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 9.13E-19 mr1403 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 8.59E-08 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 5.88E-07 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.45E-07 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.41E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 2.63E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.72E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.45E-07 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 1.22E-08 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 2.30E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 5.39E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 1.49E-08 1.36E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 8.72E-10 1.67E-17 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 7.67E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 3.19E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 5.95E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 3.09E-06 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 2.38E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 6.25E-06 NA mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 NA 2.36E-11 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 1.18E-07 4.17E-18 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407150917 1.55E-09 6.30E-27 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251