\
| Variant ID: vg0407142997 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7142997 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
TATATTGTCCATGAGCAAGTGAGCCTTTGCTACAATTAATTAAGATGGCTGGTAAGGTTATAAGTAGAACAAATAACATGTACTGTCATAATTTATAATT[C/T]
AAATTGTTGAAATCACTAGTAATCACATACACTACTACTTTCTCTGTTTCATATTATAAATCTAGACATATATGTACATATTCATTAATATCTATATGAA
TTCATATAGATATTAATGAATATGTACATATATGTCTAGATTTATAATATGAAACAGAGAAAGTAGTAGTGTATGTGATTACTAGTGATTTCAACAATTT[G/A]
AATTATAAATTATGACAGTACATGTTATTTGTTCTACTTATAACCTTACCAGCCATCTTAATTAATTGTAGCAAAGGCTCACTTGCTCATGGACAATATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 6.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 89.20% | 10.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 16.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407142997 | C -> T | LOC_Os04g12920-LOC_Os04g12950 | intergenic_region ; MODIFIER | silent_mutation | Average:42.253; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407142997 | NA | 8.59E-06 | mr1207 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 7.74E-06 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 4.33E-06 | mr1354 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 7.04E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 7.68E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 1.75E-06 | mr1622 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 4.12E-06 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 2.34E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | 3.95E-06 | 1.44E-06 | mr1665 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | NA | 6.96E-06 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407142997 | 1.33E-06 | 1.33E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |