\
| Variant ID: vg0407141000 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7141000 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 55. )
TACTCACAATACACATACACCCATATAAACGCACATATACACCCAACCTTTATTAGCACCTCGAAAAGACTGAACTTGTATATCTTGAGAGTGATAAAGT[T/C]
ATCTCTAGCACCTCGTTGTTAATAAGTACGTCGCCTAGAATTGAAAAAAATAATTAGCCGTAAATACGAGTACTCAAAATATATTGTACTCCATGTTCTA
TAGAACATGGAGTACAATATATTTTGAGTACTCGTATTTACGGCTAATTATTTTTTTCAATTCTAGGCGACGTACTTATTAACAACGAGGTGCTAGAGAT[A/G]
ACTTTATCACTCTCAAGATATACAAGTTCAGTCTTTTCGAGGTGCTAATAAAGGTTGGGTGTATATGTGCGTTTATATGGGTGTATGTGTATTGTGAGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 17.40% | 2.64% | 52.54% | NA |
| All Indica | 2759 | 32.40% | 1.20% | 2.43% | 63.97% | NA |
| All Japonica | 1512 | 14.40% | 48.70% | 2.78% | 34.13% | NA |
| Aus | 269 | 42.80% | 0.70% | 3.72% | 52.79% | NA |
| Indica I | 595 | 20.30% | 0.70% | 1.51% | 77.48% | NA |
| Indica II | 465 | 42.40% | 1.70% | 1.51% | 54.41% | NA |
| Indica III | 913 | 34.00% | 0.50% | 3.94% | 61.56% | NA |
| Indica Intermediate | 786 | 34.00% | 1.90% | 1.91% | 62.21% | NA |
| Temperate Japonica | 767 | 20.60% | 73.10% | 4.56% | 1.69% | NA |
| Tropical Japonica | 504 | 5.40% | 7.10% | 0.40% | 87.10% | NA |
| Japonica Intermediate | 241 | 13.70% | 57.70% | 2.07% | 26.56% | NA |
| VI/Aromatic | 96 | 41.70% | 33.30% | 0.00% | 25.00% | NA |
| Intermediate | 90 | 28.90% | 24.40% | 6.67% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407141000 | T -> C | LOC_Os04g12920.1 | upstream_gene_variant ; 3349.0bp to feature; MODIFIER | silent_mutation | Average:44.905; most accessible tissue: Callus, score: 88.672 | N | N | N | N |
| vg0407141000 | T -> C | LOC_Os04g12920-LOC_Os04g12950 | intergenic_region ; MODIFIER | silent_mutation | Average:44.905; most accessible tissue: Callus, score: 88.672 | N | N | N | N |
| vg0407141000 | T -> DEL | N | N | silent_mutation | Average:44.905; most accessible tissue: Callus, score: 88.672 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407141000 | 3.11E-06 | 3.18E-23 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | 4.73E-07 | 2.42E-37 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 4.42E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 1.69E-09 | mr1785 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | 1.26E-07 | 7.43E-42 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 1.07E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 5.18E-10 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 3.35E-08 | mr1399_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 9.72E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | 1.14E-06 | NA | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407141000 | NA | 4.32E-06 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |