\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407141000:

Variant ID: vg0407141000 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7141000
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


TACTCACAATACACATACACCCATATAAACGCACATATACACCCAACCTTTATTAGCACCTCGAAAAGACTGAACTTGTATATCTTGAGAGTGATAAAGT[T/C]
ATCTCTAGCACCTCGTTGTTAATAAGTACGTCGCCTAGAATTGAAAAAAATAATTAGCCGTAAATACGAGTACTCAAAATATATTGTACTCCATGTTCTA

Reverse complement sequence

TAGAACATGGAGTACAATATATTTTGAGTACTCGTATTTACGGCTAATTATTTTTTTCAATTCTAGGCGACGTACTTATTAACAACGAGGTGCTAGAGAT[A/G]
ACTTTATCACTCTCAAGATATACAAGTTCAGTCTTTTCGAGGTGCTAATAAAGGTTGGGTGTATATGTGCGTTTATATGGGTGTATGTGTATTGTGAGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 17.40% 2.64% 52.54% NA
All Indica  2759 32.40% 1.20% 2.43% 63.97% NA
All Japonica  1512 14.40% 48.70% 2.78% 34.13% NA
Aus  269 42.80% 0.70% 3.72% 52.79% NA
Indica I  595 20.30% 0.70% 1.51% 77.48% NA
Indica II  465 42.40% 1.70% 1.51% 54.41% NA
Indica III  913 34.00% 0.50% 3.94% 61.56% NA
Indica Intermediate  786 34.00% 1.90% 1.91% 62.21% NA
Temperate Japonica  767 20.60% 73.10% 4.56% 1.69% NA
Tropical Japonica  504 5.40% 7.10% 0.40% 87.10% NA
Japonica Intermediate  241 13.70% 57.70% 2.07% 26.56% NA
VI/Aromatic  96 41.70% 33.30% 0.00% 25.00% NA
Intermediate  90 28.90% 24.40% 6.67% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407141000 T -> C LOC_Os04g12920.1 upstream_gene_variant ; 3349.0bp to feature; MODIFIER silent_mutation Average:44.905; most accessible tissue: Callus, score: 88.672 N N N N
vg0407141000 T -> C LOC_Os04g12920-LOC_Os04g12950 intergenic_region ; MODIFIER silent_mutation Average:44.905; most accessible tissue: Callus, score: 88.672 N N N N
vg0407141000 T -> DEL N N silent_mutation Average:44.905; most accessible tissue: Callus, score: 88.672 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407141000 3.11E-06 3.18E-23 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 4.73E-07 2.42E-37 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 4.42E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 1.69E-09 mr1785 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 1.26E-07 7.43E-42 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 1.07E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 5.18E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 3.35E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 9.72E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 1.14E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407141000 NA 4.32E-06 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251