\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407133877:

Variant ID: vg0407133877 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7133877
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.18, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCATAAGAGAATTCTATAATTTAACAGCAATATCTTTAACACCACTATTTTCACTTTTGTGGAGCATGGTATAAAGAAGCAATGGAAACCATTATTCA[C/T]
ATATGTTTACACATATCATGACACTTAATGTATGCAACTGAATATTCACCAAATAAATTTGTAATCACGTTGTTTTTGTGTTGTGAGCTGAATCATGTAG

Reverse complement sequence

CTACATGATTCAGCTCACAACACAAAAACAACGTGATTACAAATTTATTTGGTGAATATTCAGTTGCATACATTAAGTGTCATGATATGTGTAAACATAT[G/A]
TGAATAATGGTTTCCATTGCTTCTTTATACCATGCTCCACAAAAGTGAAAATAGTGGTGTTAAAGATATTGCTGTTAAATTATAGAATTCTCTTATGCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 21.50% 0.38% 13.69% NA
All Indica  2759 94.20% 1.10% 0.43% 4.28% NA
All Japonica  1512 4.80% 61.60% 0.33% 33.20% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 97.00% 0.70% 0.34% 2.02% NA
Indica II  465 92.30% 2.20% 0.22% 5.38% NA
Indica III  913 95.90% 0.30% 0.44% 3.29% NA
Indica Intermediate  786 91.30% 1.50% 0.64% 6.49% NA
Temperate Japonica  767 2.20% 96.00% 0.13% 1.69% NA
Tropical Japonica  504 6.30% 8.30% 0.40% 84.92% NA
Japonica Intermediate  241 10.00% 63.90% 0.83% 25.31% NA
VI/Aromatic  96 52.10% 33.30% 0.00% 14.58% NA
Intermediate  90 57.80% 27.80% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407133877 C -> DEL N N silent_mutation Average:34.875; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0407133877 C -> T LOC_Os04g12900.1 downstream_gene_variant ; 2982.0bp to feature; MODIFIER silent_mutation Average:34.875; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0407133877 C -> T LOC_Os04g12920.1 downstream_gene_variant ; 3339.0bp to feature; MODIFIER silent_mutation Average:34.875; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0407133877 C -> T LOC_Os04g12900-LOC_Os04g12920 intergenic_region ; MODIFIER silent_mutation Average:34.875; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407133877 NA 1.21E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 3.86E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.29E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 4.30E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 5.26E-07 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 2.28E-10 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.43E-08 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 4.27E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 4.02E-07 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.53E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.02E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.12E-10 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 7.00E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 3.93E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 4.98E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.38E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 2.86E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 8.03E-06 NA mr1719 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 2.24E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.15E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 2.92E-45 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 3.54E-35 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 3.54E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 1.09E-06 1.46E-35 mr1789 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 3.77E-14 mr1789 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 6.85E-26 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 2.40E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 5.84E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 6.05E-12 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.62E-40 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 8.46E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.48E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.46E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 1.58E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 5.00E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 2.22E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407133877 NA 2.73E-06 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251