\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407132799:

Variant ID: vg0407132799 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7132799
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.01, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAACAGTACAAATCGACATAAACTAACTTCGAACACCAAAAATATAATGATCAAATTAACCATAAATATAATTAAATTTTTTCCTGATTAGTTCCATC[C/T]
AGCACCTAAAAAACTTCCAATATAATGACACTTATGCAAACATGTAGTTAACTTCCATAGCTATGAGTCTTCATGTGTTGGATATTCAAGAATCTAGAAA

Reverse complement sequence

TTTCTAGATTCTTGAATATCCAACACATGAAGACTCATAGCTATGGAAGTTAACTACATGTTTGCATAAGTGTCATTATATTGGAAGTTTTTTAGGTGCT[G/A]
GATGGAACTAATCAGGAAAAAATTTAATTATATTTATGGTTAATTTGATCATTATATTTTTGGTGTTCGAAGTTAGTTTATGTCGATTTGTACTGTTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 26.50% 0.70% 18.07% NA
All Indica  2759 42.70% 44.60% 0.83% 11.82% NA
All Japonica  1512 66.60% 0.50% 0.60% 32.28% NA
Aus  269 96.70% 0.40% 0.00% 2.97% NA
Indica I  595 21.30% 74.30% 0.50% 3.87% NA
Indica II  465 45.60% 26.00% 1.94% 26.45% NA
Indica III  913 56.70% 37.30% 0.11% 5.81% NA
Indica Intermediate  786 41.00% 41.60% 1.27% 16.16% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 15.10% 1.00% 1.39% 82.54% NA
Japonica Intermediate  241 73.40% 1.20% 0.83% 24.48% NA
VI/Aromatic  96 84.40% 0.00% 1.04% 14.58% NA
Intermediate  90 64.40% 15.60% 0.00% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407132799 C -> DEL N N silent_mutation Average:29.931; most accessible tissue: Callus, score: 60.157 N N N N
vg0407132799 C -> T LOC_Os04g12900.1 downstream_gene_variant ; 1904.0bp to feature; MODIFIER silent_mutation Average:29.931; most accessible tissue: Callus, score: 60.157 N N N N
vg0407132799 C -> T LOC_Os04g12920.1 downstream_gene_variant ; 4417.0bp to feature; MODIFIER silent_mutation Average:29.931; most accessible tissue: Callus, score: 60.157 N N N N
vg0407132799 C -> T LOC_Os04g12900-LOC_Os04g12920 intergenic_region ; MODIFIER silent_mutation Average:29.931; most accessible tissue: Callus, score: 60.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407132799 NA 4.62E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 1.36E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 1.31E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 3.58E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 4.95E-06 NA mr1830 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 2.06E-09 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 1.41E-10 NA mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 2.66E-10 2.73E-17 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 3.86E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 6.70E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 2.84E-07 NA mr1830_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 NA 5.43E-14 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 7.32E-11 3.71E-16 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407132799 1.86E-08 1.52E-27 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251