\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407118586:

Variant ID: vg0407118586 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7118586
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCTCGCGAGGATCATGCATGTGGAGGCACACTTGCTGAACGGCATAGGAGATGTTCGGTCTGGTGAAGGTGAGGTACTGGAGGGCCCCCACTAGGCTG[T/C]
GGAAGTCAGTCGGGTCTGCGACCGGTGTACCGTCGGAAGCTTGGAGGCGGTGTCGACGGGAGTGGTACAAGGCTTGCAGTCTGTCATGCCGGCACGGTCG

Reverse complement sequence

CGACCGTGCCGGCATGACAGACTGCAAGCCTTGTACCACTCCCGTCGACACCGCCTCCAAGCTTCCGACGGTACACCGGTCGCAGACCCGACTGACTTCC[A/G]
CAGCCTAGTGGGGGCCCTCCAGTACCTCACCTTCACCAGACCGAACATCTCCTATGCCGTTCAGCAAGTGTGCCTCCACATGCATGATCCTCGCGAGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.20% 22.00% 1.06% 52.75% NA
All Indica  2759 32.80% 1.50% 0.94% 64.77% NA
All Japonica  1512 3.80% 62.00% 0.20% 34.06% NA
Aus  269 43.50% 0.40% 7.81% 48.33% NA
Indica I  595 20.50% 1.50% 0.84% 77.14% NA
Indica II  465 42.40% 2.20% 0.65% 54.84% NA
Indica III  913 34.20% 0.70% 0.88% 64.29% NA
Indica Intermediate  786 34.90% 2.00% 1.27% 61.83% NA
Temperate Japonica  767 2.10% 96.10% 0.13% 1.69% NA
Tropical Japonica  504 3.80% 9.10% 0.20% 86.90% NA
Japonica Intermediate  241 9.10% 63.90% 0.41% 26.56% NA
VI/Aromatic  96 41.70% 34.40% 0.00% 23.96% NA
Intermediate  90 28.90% 28.90% 0.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407118586 T -> C LOC_Os04g12890.1 upstream_gene_variant ; 3051.0bp to feature; MODIFIER silent_mutation Average:57.671; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N
vg0407118586 T -> C LOC_Os04g12864.1 downstream_gene_variant ; 3578.0bp to feature; MODIFIER silent_mutation Average:57.671; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N
vg0407118586 T -> C LOC_Os04g12880.1 intron_variant ; MODIFIER silent_mutation Average:57.671; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N
vg0407118586 T -> DEL N N silent_mutation Average:57.671; most accessible tissue: Zhenshan97 panicle, score: 91.206 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407118586 T C -0.02 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407118586 NA 3.28E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 2.68E-06 6.12E-93 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 2.18E-29 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.17E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 1.31E-06 2.84E-86 mr1080 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.13E-76 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 8.33E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 7.08E-06 2.97E-91 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 3.68E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.83E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.20E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 3.52E-31 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 5.93E-06 NA mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 1.54E-06 NA mr1543 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 6.12E-44 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.71E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 4.48E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.61E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.18E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 1.25E-06 5.45E-94 mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 7.78E-71 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 4.10E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 5.81E-26 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 1.64E-06 3.61E-42 mr1719 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 2.05E-29 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 3.24E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.49E-73 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 1.85E-06 3.16E-25 mr1805 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 9.60E-06 3.34E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 8.50E-71 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 4.69E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 2.32E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 7.33E-73 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 2.85E-61 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 2.25E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 3.28E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407118586 NA 1.39E-72 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251