Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407116784:

Variant ID: vg0407116784 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7116784
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.25, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGCCTATAAGTATATTTTTCAGAAGAAATCTCCATAGGTGAACAGTGAATCCAAAAATAGCACTCAATTGATCCACCTCAGCAATGAAAGCTAAACCG[A/T]
CCGATGGAGAAAAAAAAGAGCAGCCGTAGGATTGGATCAATGAAAGCTGGATTTTTCTGTAACTTTCCAGTGCCTGCCTTACATGTGTTAGAGAGAGAAA

Reverse complement sequence

TTTCTCTCTCTAACACATGTAAGGCAGGCACTGGAAAGTTACAGAAAAATCCAGCTTTCATTGATCCAATCCTACGGCTGCTCTTTTTTTTCTCCATCGG[T/A]
CGGTTTAGCTTTCATTGCTGAGGTGGATCAATTGAGTGCTATTTTTGGATTCACTGTTCACCTATGGAGATTTCTTCTGAAAAATATACTTATAGGCTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.60% 18.20% 0.57% 53.60% NA
All Indica  2759 32.50% 1.40% 0.62% 65.42% NA
All Japonica  1512 14.90% 50.50% 0.60% 33.99% NA
Aus  269 42.80% 0.00% 0.00% 57.25% NA
Indica I  595 20.20% 1.70% 1.01% 77.14% NA
Indica II  465 42.20% 2.40% 0.43% 55.05% NA
Indica III  913 33.80% 0.40% 0.44% 65.28% NA
Indica Intermediate  786 34.70% 1.80% 0.64% 62.85% NA
Temperate Japonica  767 22.30% 75.20% 0.91% 1.56% NA
Tropical Japonica  504 5.40% 7.50% 0.20% 86.90% NA
Japonica Intermediate  241 11.60% 61.40% 0.41% 26.56% NA
VI/Aromatic  96 40.60% 34.40% 1.04% 23.96% NA
Intermediate  90 31.10% 27.80% 0.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407116784 A -> DEL N N silent_mutation Average:41.315; most accessible tissue: Callus, score: 85.73 N N N N
vg0407116784 A -> T LOC_Os04g12890.1 upstream_gene_variant ; 4853.0bp to feature; MODIFIER silent_mutation Average:41.315; most accessible tissue: Callus, score: 85.73 N N N N
vg0407116784 A -> T LOC_Os04g12864.1 downstream_gene_variant ; 1776.0bp to feature; MODIFIER silent_mutation Average:41.315; most accessible tissue: Callus, score: 85.73 N N N N
vg0407116784 A -> T LOC_Os04g12880.1 downstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:41.315; most accessible tissue: Callus, score: 85.73 N N N N
vg0407116784 A -> T LOC_Os04g12864-LOC_Os04g12880 intergenic_region ; MODIFIER silent_mutation Average:41.315; most accessible tissue: Callus, score: 85.73 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0407116784 A T -0.09 -0.04 -0.03 0.04 -0.08 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407116784 2.17E-06 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 5.31E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 2.66E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 1.02E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 1.74E-06 NA mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 7.13E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 1.72E-08 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 1.38E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 4.31E-06 1.13E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 2.48E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407116784 NA 4.57E-14 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251