\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407098060:

Variant ID: vg0407098060 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7098060
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCTGAAAAGACAGTGAAATGCTTTTCCACTTGCAGATACAGGAAAAATTGGTAAACAAAAATAACAGTCGGCCCTGATTTCTTCCTCTTATCCCTTA[A/G]
TTTAAGAGGCAAGGACTGACATCAAGTTTACAAATTTTCAAAGTGGGTATAAAGTGATACATCTTAAACTCTGCTTAGTATAGCATAACATGAGAAAGCA

Reverse complement sequence

TGCTTTCTCATGTTATGCTATACTAAGCAGAGTTTAAGATGTATCACTTTATACCCACTTTGAAAATTTGTAAACTTGATGTCAGTCCTTGCCTCTTAAA[T/C]
TAAGGGATAAGAGGAAGAAATCAGGGCCGACTGTTATTTTTGTTTACCAATTTTTCCTGTATCTGCAAGTGGAAAAGCATTTCACTGTCTTTTCAGAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.80% 22.50% 0.49% 53.26% NA
All Indica  2759 2.90% 31.30% 0.69% 65.13% NA
All Japonica  1512 64.90% 1.20% 0.13% 33.73% NA
Aus  269 0.40% 43.10% 0.00% 56.51% NA
Indica I  595 1.50% 20.30% 1.01% 77.14% NA
Indica II  465 3.20% 41.30% 1.08% 54.41% NA
Indica III  913 3.20% 31.50% 0.22% 65.06% NA
Indica Intermediate  786 3.40% 33.30% 0.76% 62.47% NA
Temperate Japonica  767 97.90% 0.40% 0.00% 1.69% NA
Tropical Japonica  504 11.50% 1.80% 0.40% 86.31% NA
Japonica Intermediate  241 71.80% 2.50% 0.00% 25.73% NA
VI/Aromatic  96 34.40% 40.60% 2.08% 22.92% NA
Intermediate  90 32.20% 27.80% 0.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407098060 A -> DEL N N silent_mutation Average:26.122; most accessible tissue: Callus, score: 76.152 N N N N
vg0407098060 A -> G LOC_Os04g12850.1 downstream_gene_variant ; 2601.0bp to feature; MODIFIER silent_mutation Average:26.122; most accessible tissue: Callus, score: 76.152 N N N N
vg0407098060 A -> G LOC_Os04g12830-LOC_Os04g12850 intergenic_region ; MODIFIER silent_mutation Average:26.122; most accessible tissue: Callus, score: 76.152 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407098060 1.01E-08 1.79E-11 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407098060 NA 2.36E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407098060 NA 1.47E-10 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407098060 6.99E-06 4.25E-06 mr1855_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251