Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407013946:

Variant ID: vg0407013946 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7013946
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

TCACAAATCAAATATTAAATAATCAAACCATGTTGATAGCCTGATTTCATATTTAACAAAAGGAAACAACATGGTTGAATATGATTCACTTGAATCCAAT[C/T]
TCACATGAGATATAAGAACACATGAAATGATGATCACCACTATAATGAGATATAAGCCAATGCCCCGTTCAGGGAATCCAAAACCTCTGTATCAGCAATT

Reverse complement sequence

AATTGCTGATACAGAGGTTTTGGATTCCCTGAACGGGGCATTGGCTTATATCTCATTATAGTGGTGATCATCATTTCATGTGTTCTTATATCTCATGTGA[G/A]
ATTGGATTCAAGTGAATCATATTCAACCATGTTGTTTCCTTTTGTTAAATATGAAATCAGGCTATCAACATGGTTTGATTATTTAATATTTGATTTGTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.00%	26.70%	2.71%	37.58%	NA
All Indica	2759	11.20%	45.10%	4.10%	39.69%	NA
All Japonica	1512	66.70%	0.30%	0.66%	32.41%	NA
Aus	269	58.70%	0.40%	0.00%	40.89%	NA
Indica I	595	2.00%	74.60%	0.00%	23.36%	NA
Indica II	465	6.00%	25.80%	19.35%	48.82%	NA
Indica III	913	21.90%	37.80%	0.55%	39.76%	NA
Indica Intermediate	786	8.70%	42.50%	2.29%	46.56%	NA
Temperate Japonica	767	98.00%	0.00%	0.13%	1.83%	NA
Tropical Japonica	504	16.10%	0.20%	1.59%	82.14%	NA
Japonica Intermediate	241	72.60%	1.20%	0.41%	25.73%	NA
VI/Aromatic	96	52.10%	0.00%	0.00%	47.92%	NA
Intermediate	90	40.00%	15.60%	5.56%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407013946	C -> DEL	N	N	silent_mutation	Average:15.774; most accessible tissue: Callus, score: 51.509	N	N	N	N
vg0407013946	C -> T	LOC_Os04g12660.1	downstream_gene_variant ; 3858.0bp to feature; MODIFIER	silent_mutation	Average:15.774; most accessible tissue: Callus, score: 51.509	N	N	N	N
vg0407013946	C -> T	LOC_Os04g12669.1	downstream_gene_variant ; 396.0bp to feature; MODIFIER	silent_mutation	Average:15.774; most accessible tissue: Callus, score: 51.509	N	N	N	N
vg0407013946	C -> T	LOC_Os04g12660-LOC_Os04g12669	intergenic_region ; MODIFIER	silent_mutation	Average:15.774; most accessible tissue: Callus, score: 51.509	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407013946	NA	7.76E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	7.01E-09	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	8.87E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	1.05E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	2.90E-13	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	3.54E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	1.90E-08	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	1.45E-06	NA	mr1071_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	4.45E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	7.93E-06	4.08E-08	mr1203_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	2.45E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	NA	4.58E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946	9.23E-08	2.42E-08	mr1613_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251