\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407013946:

Variant ID: vg0407013946 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7013946
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


TCACAAATCAAATATTAAATAATCAAACCATGTTGATAGCCTGATTTCATATTTAACAAAAGGAAACAACATGGTTGAATATGATTCACTTGAATCCAAT[C/T]
TCACATGAGATATAAGAACACATGAAATGATGATCACCACTATAATGAGATATAAGCCAATGCCCCGTTCAGGGAATCCAAAACCTCTGTATCAGCAATT

Reverse complement sequence

AATTGCTGATACAGAGGTTTTGGATTCCCTGAACGGGGCATTGGCTTATATCTCATTATAGTGGTGATCATCATTTCATGTGTTCTTATATCTCATGTGA[G/A]
ATTGGATTCAAGTGAATCATATTCAACCATGTTGTTTCCTTTTGTTAAATATGAAATCAGGCTATCAACATGGTTTGATTATTTAATATTTGATTTGTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.00% 26.70% 2.71% 37.58% NA
All Indica  2759 11.20% 45.10% 4.10% 39.69% NA
All Japonica  1512 66.70% 0.30% 0.66% 32.41% NA
Aus  269 58.70% 0.40% 0.00% 40.89% NA
Indica I  595 2.00% 74.60% 0.00% 23.36% NA
Indica II  465 6.00% 25.80% 19.35% 48.82% NA
Indica III  913 21.90% 37.80% 0.55% 39.76% NA
Indica Intermediate  786 8.70% 42.50% 2.29% 46.56% NA
Temperate Japonica  767 98.00% 0.00% 0.13% 1.83% NA
Tropical Japonica  504 16.10% 0.20% 1.59% 82.14% NA
Japonica Intermediate  241 72.60% 1.20% 0.41% 25.73% NA
VI/Aromatic  96 52.10% 0.00% 0.00% 47.92% NA
Intermediate  90 40.00% 15.60% 5.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407013946 C -> DEL N N silent_mutation Average:15.774; most accessible tissue: Callus, score: 51.509 N N N N
vg0407013946 C -> T LOC_Os04g12660.1 downstream_gene_variant ; 3858.0bp to feature; MODIFIER silent_mutation Average:15.774; most accessible tissue: Callus, score: 51.509 N N N N
vg0407013946 C -> T LOC_Os04g12669.1 downstream_gene_variant ; 396.0bp to feature; MODIFIER silent_mutation Average:15.774; most accessible tissue: Callus, score: 51.509 N N N N
vg0407013946 C -> T LOC_Os04g12660-LOC_Os04g12669 intergenic_region ; MODIFIER silent_mutation Average:15.774; most accessible tissue: Callus, score: 51.509 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407013946 NA 7.76E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 7.01E-09 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 8.87E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 1.05E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 2.90E-13 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 3.54E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 1.90E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 1.45E-06 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 4.45E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 7.93E-06 4.08E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 2.45E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 NA 4.58E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407013946 9.23E-08 2.42E-08 mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251