\
| Variant ID: vg0407008360 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7008360 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.10, others allele: 0.00, population size: 68. )
ACCCATATAAACGCACACATACACCCAACCTTTATTAGCGCCTCGAAAAGACCGAACTTGCATATTTTGAGAGTGACAAAGTCATCACTGGTACCTCGTT[A/G,T]
TCGATAAGTACGTTGTCTAGAATTGAAAAAAATAATTAGCTGTAAATATGAGTACTAAAAAATATATTGTACTCCTCTATGTTCTATCTATTATATGCAA
TTGCATATAATAGATAGAACATAGAGGAGTACAATATATTTTTTAGTACTCATATTTACAGCTAATTATTTTTTTCAATTCTAGACAACGTACTTATCGA[T/C,A]
AACGAGGTACCAGTGATGACTTTGTCACTCTCAAAATATGCAAGTTCGGTCTTTTCGAGGCGCTAATAAAGGTTGGGTGTATGTGTGCGTTTATATGGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 32.00% | 0.06% | 0.00% | T: 0.02% |
| All Indica | 2759 | 51.80% | 48.10% | 0.07% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 43.10% | 56.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 24.50% | 75.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.30% | 44.50% | 0.11% | 0.00% | T: 0.11% |
| Indica Intermediate | 786 | 54.60% | 45.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 18.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407008360 | A -> G | LOC_Os04g12639.1 | upstream_gene_variant ; 2728.0bp to feature; MODIFIER | silent_mutation | Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0407008360 | A -> G | LOC_Os04g12660.1 | upstream_gene_variant ; 599.0bp to feature; MODIFIER | silent_mutation | Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0407008360 | A -> G | LOC_Os04g12639-LOC_Os04g12660 | intergenic_region ; MODIFIER | silent_mutation | Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0407008360 | A -> T | LOC_Os04g12639.1 | upstream_gene_variant ; 2728.0bp to feature; MODIFIER | silent_mutation | Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0407008360 | A -> T | LOC_Os04g12660.1 | upstream_gene_variant ; 599.0bp to feature; MODIFIER | silent_mutation | Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| vg0407008360 | A -> T | LOC_Os04g12639-LOC_Os04g12660 | intergenic_region ; MODIFIER | silent_mutation | Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407008360 | NA | 1.24E-06 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 1.84E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 4.00E-07 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 6.47E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | 5.11E-07 | 2.80E-12 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 5.98E-08 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 3.11E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 2.63E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 6.40E-09 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 6.56E-16 | mr1835_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | NA | 1.93E-07 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | 6.92E-06 | NA | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407008360 | 2.69E-08 | 1.83E-23 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |