Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407008360:

Variant ID: vg0407008360 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7008360
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.10, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCATATAAACGCACACATACACCCAACCTTTATTAGCGCCTCGAAAAGACCGAACTTGCATATTTTGAGAGTGACAAAGTCATCACTGGTACCTCGTT[A/G,T]
TCGATAAGTACGTTGTCTAGAATTGAAAAAAATAATTAGCTGTAAATATGAGTACTAAAAAATATATTGTACTCCTCTATGTTCTATCTATTATATGCAA

Reverse complement sequence

TTGCATATAATAGATAGAACATAGAGGAGTACAATATATTTTTTAGTACTCATATTTACAGCTAATTATTTTTTTCAATTCTAGACAACGTACTTATCGA[T/C,A]
AACGAGGTACCAGTGATGACTTTGTCACTCTCAAAATATGCAAGTTCGGTCTTTTCGAGGCGCTAATAAAGGTTGGGTGTATGTGTGCGTTTATATGGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 32.00% 0.06% 0.00% T: 0.02%
All Indica  2759 51.80% 48.10% 0.07% 0.00% T: 0.04%
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 43.10% 56.90% 0.00% 0.00% NA
Indica I  595 24.50% 75.30% 0.17% 0.00% NA
Indica II  465 74.80% 25.20% 0.00% 0.00% NA
Indica III  913 55.30% 44.50% 0.11% 0.00% T: 0.11%
Indica Intermediate  786 54.60% 45.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407008360 A -> G LOC_Os04g12639.1 upstream_gene_variant ; 2728.0bp to feature; MODIFIER silent_mutation Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0407008360 A -> G LOC_Os04g12660.1 upstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0407008360 A -> G LOC_Os04g12639-LOC_Os04g12660 intergenic_region ; MODIFIER silent_mutation Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0407008360 A -> T LOC_Os04g12639.1 upstream_gene_variant ; 2728.0bp to feature; MODIFIER silent_mutation Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0407008360 A -> T LOC_Os04g12660.1 upstream_gene_variant ; 599.0bp to feature; MODIFIER silent_mutation Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N
vg0407008360 A -> T LOC_Os04g12639-LOC_Os04g12660 intergenic_region ; MODIFIER silent_mutation Average:38.519; most accessible tissue: Zhenshan97 root, score: 57.64 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407008360 NA 1.24E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 1.84E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 4.00E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 6.47E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 5.11E-07 2.80E-12 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 5.98E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 3.11E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 2.63E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 6.40E-09 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 6.56E-16 mr1835_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 NA 1.93E-07 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 6.92E-06 NA mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407008360 2.69E-08 1.83E-23 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251