\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407006066:

Variant ID: vg0407006066 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7006066
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, A: 0.35, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TACAGAATTATTGGCACAAAAAATATTGCAACGATATATAAATTGTTGCAATTAGTTAGTCAGTGATTGAGTCCACGACTCCTCCTCGTTGTAACCGTCC[A/C]
TGCTTCCCCATTCTTCTCTCTCGCTCTGTCCCTCTCTCTCGCCACGCGCAACCGTTGTCGGTCGTCGAGACGCCGCCACTGTGTGCCTCTTGGCTCCCAG

Reverse complement sequence

CTGGGAGCCAAGAGGCACACAGTGGCGGCGTCTCGACGACCGACAACGGTTGCGCGTGGCGAGAGAGAGGGACAGAGCGAGAGAGAAGAATGGGGAAGCA[T/G]
GGACGGTTACAACGAGGAGGAGTCGTGGACTCAATCACTGACTAACTAATTGCAACAATTTATATATCGTTGCAATATTTTTTGTGCCAATAATTCTGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 34.30% 0.49% 8.46% NA
All Indica  2759 84.10% 1.20% 0.65% 14.14% NA
All Japonica  1512 1.30% 98.50% 0.07% 0.13% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.00% 1.00% 0.00% 4.03% NA
Indica II  465 87.30% 2.20% 0.43% 10.11% NA
Indica III  913 78.20% 0.40% 0.77% 20.59% NA
Indica Intermediate  786 80.70% 1.50% 1.15% 16.67% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 2.00% 97.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 44.80% 55.20% 0.00% 0.00% NA
Intermediate  90 38.90% 47.80% 4.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407006066 A -> C LOC_Os04g12639.1 upstream_gene_variant ; 434.0bp to feature; MODIFIER silent_mutation Average:49.966; most accessible tissue: Callus, score: 81.577 N N N N
vg0407006066 A -> C LOC_Os04g12660.1 upstream_gene_variant ; 2893.0bp to feature; MODIFIER silent_mutation Average:49.966; most accessible tissue: Callus, score: 81.577 N N N N
vg0407006066 A -> C LOC_Os04g12639-LOC_Os04g12660 intergenic_region ; MODIFIER silent_mutation Average:49.966; most accessible tissue: Callus, score: 81.577 N N N N
vg0407006066 A -> DEL N N silent_mutation Average:49.966; most accessible tissue: Callus, score: 81.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407006066 NA 2.50E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 2.13E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 1.96E-25 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 2.01E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 8.04E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 8.71E-06 8.71E-06 mr1340 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 7.88E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 4.60E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 1.02E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 3.17E-27 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 1.37E-11 mr1637 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 8.21E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 9.02E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 4.08E-06 4.08E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 5.21E-23 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 6.28E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 3.68E-06 3.68E-06 mr1964 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 8.66E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 8.86E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 3.09E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407006066 NA 2.43E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251