\
| Variant ID: vg0406998246 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6998246 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.35, others allele: 0.00, population size: 86. )
GAACTGCAAAGCCACACTAATAATTATATGCATTGGAACTATTTCTATTTAATTAAGGACACATTGGAATACATAGAATGGCTTGATGACACAAATCCTA[G/A]
ATGATTCATTATATATATATGTGATACCATATACAGTTTGACTCGTAAGATGGATCAACGTGCTCTTAGGAAGCATAAACCCATTAAGTTACAAAGATAT
ATATCTTTGTAACTTAATGGGTTTATGCTTCCTAAGAGCACGTTGATCCATCTTACGAGTCAAACTGTATATGGTATCACATATATATATAATGAATCAT[C/T]
TAGGATTTGTGTCATCAAGCCATTCTATGTATTCCAATGTGTCCTTAATTAAATAGAAATAGTTCCAATGCATATAATTATTAGTGTGGCTTTGCAGTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 46.50% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 78.30% | 21.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 64.90% | 34.60% | 0.43% | 0.00% | NA |
| Indica III | 913 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.10% | 22.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 44.80% | 55.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 57.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406998246 | G -> A | LOC_Os04g12620.1 | upstream_gene_variant ; 2942.0bp to feature; MODIFIER | silent_mutation | Average:38.888; most accessible tissue: Callus, score: 65.429 | N | N | N | N |
| vg0406998246 | G -> A | LOC_Os04g12639.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.888; most accessible tissue: Callus, score: 65.429 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406998246 | NA | 2.15E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 2.33E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 1.04E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 4.56E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 1.18E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 4.87E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | 4.07E-06 | 6.18E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 3.88E-20 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 4.56E-14 | mr1097_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 1.03E-20 | mr1146_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 9.77E-15 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 2.20E-31 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 1.99E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 1.07E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 1.03E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 8.16E-06 | mr1525_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 2.70E-10 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406998246 | NA | 3.71E-15 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |