\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406995300:

Variant ID: vg0406995300 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6995300
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CCACAGCCCCCGCGGCCCCACTGCCAACTCTCTTGCGCCCCCGCCGCTTGCCACCTCATCCTCCCCTTCCTCCACCTTCGCCAGCTCTAGATCTGTCCTC[G/A]
CCATCGCCGCTGCTCCACACCGCCGCCTATCTTCCCCCTTCCCCACCTCCACCTCTAGCTGCCGCCGTCATGCAAGGGTGGCTAGACCAGAAGGGGATGC

Reverse complement sequence

GCATCCCCTTCTGGTCTAGCCACCCTTGCATGACGGCGGCAGCTAGAGGTGGAGGTGGGGAAGGGGGAAGATAGGCGGCGGTGTGGAGCAGCGGCGATGG[C/T]
GAGGACAGATCTAGAGCTGGCGAAGGTGGAGGAAGGGGAGGATGAGGTGGCAAGCGGCGGGGGCGCAAGAGAGTTGGCAGTGGGGCCGCGGGGGCTGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 26.90% 0.59% 18.79% NA
All Indica  2759 84.10% 15.40% 0.18% 0.36% NA
All Japonica  1512 2.40% 40.30% 1.26% 56.08% NA
Aus  269 38.70% 61.30% 0.00% 0.00% NA
Indica I  595 99.20% 0.70% 0.00% 0.17% NA
Indica II  465 88.60% 10.50% 0.00% 0.86% NA
Indica III  913 68.50% 31.30% 0.11% 0.11% NA
Indica Intermediate  786 88.20% 10.80% 0.51% 0.51% NA
Temperate Japonica  767 1.40% 53.50% 0.78% 44.33% NA
Tropical Japonica  504 3.20% 8.70% 2.38% 85.71% NA
Japonica Intermediate  241 3.70% 64.30% 0.41% 31.54% NA
VI/Aromatic  96 36.50% 47.90% 1.04% 14.58% NA
Intermediate  90 50.00% 28.90% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406995300 G -> DEL LOC_Os04g12620.1 N frameshift_variant Average:81.959; most accessible tissue: Zhenshan97 panicle, score: 94.195 N N N N
vg0406995300 G -> A LOC_Os04g12620.1 missense_variant ; p.Ala2Val; MODERATE nonsynonymous_codon ; A2V Average:81.959; most accessible tissue: Zhenshan97 panicle, score: 94.195 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406995300 G A 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406995300 3.58E-12 1.62E-16 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 3.75E-10 1.15E-15 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 6.98E-06 2.44E-08 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 5.85E-08 4.66E-11 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 NA 1.63E-16 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 3.36E-09 8.70E-13 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 NA 7.35E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 3.18E-08 9.39E-11 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 1.30E-06 7.49E-11 mr1613 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 6.47E-09 1.08E-11 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 5.24E-06 1.50E-08 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 NA 6.86E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 1.13E-09 2.20E-18 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 2.31E-10 1.01E-19 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 1.29E-07 4.76E-13 mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 7.40E-12 5.38E-19 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 2.25E-14 2.24E-21 mr1613_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 4.83E-07 2.30E-13 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995300 NA 2.73E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251