\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406995198:

Variant ID: vg0406995198 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6995198
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCTCCTCATGTCGCGACGGTGCCTCCGGCGCCACCTCAGGCCCCCCTGCTCCTATGGCCGCCGGTCGCCAGCTCTACCAACCAGTTCTGGCGACGCC[C/T]
GCCACAGCCCCCGCGGCCCCACTGCCAACTCTCTTGCGCCCCCGCCGCTTGCCACCTCATCCTCCCCTTCCTCCACCTTCGCCAGCTCTAGATCTGTCCT

Reverse complement sequence

AGGACAGATCTAGAGCTGGCGAAGGTGGAGGAAGGGGAGGATGAGGTGGCAAGCGGCGGGGGCGCAAGAGAGTTGGCAGTGGGGCCGCGGGGGCTGTGGC[G/A]
GGCGTCGCCAGAACTGGTTGGTAGAGCTGGCGACCGGCGGCCATAGGAGCAGGGGGGCCTGAGGTGGCGCCGGAGGCACCGTCGCGACATGAGGAGGTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 4.70% 0.68% 18.09% NA
All Indica  2759 91.90% 7.80% 0.04% 0.33% NA
All Japonica  1512 43.80% 0.30% 1.98% 53.90% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.00% 0.17% NA
Indica II  465 90.50% 8.60% 0.22% 0.65% NA
Indica III  913 96.70% 3.20% 0.00% 0.11% NA
Indica Intermediate  786 84.20% 15.30% 0.00% 0.51% NA
Temperate Japonica  767 56.20% 0.30% 2.09% 41.46% NA
Tropical Japonica  504 13.70% 0.40% 2.38% 83.53% NA
Japonica Intermediate  241 67.60% 0.00% 0.83% 31.54% NA
VI/Aromatic  96 85.40% 0.00% 0.00% 14.58% NA
Intermediate  90 73.30% 6.70% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406995198 C -> DEL LOC_Os04g12620.1 N frameshift_variant Average:80.868; most accessible tissue: Zhenshan97 panicle, score: 91.536 N N N N
vg0406995198 C -> T LOC_Os04g12620.1 missense_variant ; p.Arg36Gln; MODERATE nonsynonymous_codon ; R36Q Average:80.868; most accessible tissue: Zhenshan97 panicle, score: 91.536 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0406995198 C T 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406995198 NA 8.60E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995198 NA 2.71E-07 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995198 3.34E-06 3.34E-06 mr1340 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995198 NA 4.56E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995198 NA 6.17E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406995198 1.12E-06 1.12E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251