Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406994122:

Variant ID: vg0406994122 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6994122
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.21, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

CTAGAAAAGAAAAAATAACCACCAGCTGGCTGAACAGCTACACAGCACACGCCACAACTCACTAACAACTGAAACACTGACGGAGCCCAACGTAGGGTGT[C/T]
GTTACCAAGCTTGACCGAAAACAACATAGGGGGTTTGGACTTTGCAAACGTGTCATCGTTGCCAGGCTTGCTGCCAAGCGACACAGCAGCTCCGACTTCA

Reverse complement sequence

TGAAGTCGGAGCTGCTGTGTCGCTTGGCAGCAAGCCTGGCAACGATGACACGTTTGCAAAGTCCAAACCCCCTATGTTGTTTTCGGTCAAGCTTGGTAAC[G/A]
ACACCCTACGTTGGGCTCCGTCAGTGTTTCAGTTGTTAGTGAGTTGTGGCGTGTGCTGTGTAGCTGTTCAGCCAGCTGGTGGTTATTTTTTCTTTTCTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	16.20%	0.40%	18.18%	NA
All Indica	2759	78.90%	20.70%	0.00%	0.36%	NA
All Japonica	1512	44.00%	0.60%	1.19%	54.23%	NA
Aus	269	39.80%	60.20%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.00%	0.17%	NA
Indica II	465	85.80%	13.50%	0.00%	0.65%	NA
Indica III	913	67.50%	32.30%	0.00%	0.22%	NA
Indica Intermediate	786	75.40%	24.00%	0.00%	0.51%	NA
Temperate Japonica	767	57.50%	0.50%	1.43%	40.55%	NA
Tropical Japonica	504	11.90%	0.80%	1.19%	86.11%	NA
Japonica Intermediate	241	68.00%	0.40%	0.41%	31.12%	NA
VI/Aromatic	96	76.00%	9.40%	0.00%	14.58%	NA
Intermediate	90	67.80%	14.40%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406994122	C -> DEL	N	N	silent_mutation	Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0406994122	C -> T	LOC_Os04g12620.1	downstream_gene_variant ; 225.0bp to feature; MODIFIER	silent_mutation	Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0406994122	C -> T	LOC_Os04g12639.1	downstream_gene_variant ; 2741.0bp to feature; MODIFIER	silent_mutation	Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N
vg0406994122	C -> T	LOC_Os04g12610-LOC_Os04g12620	intergenic_region ; MODIFIER	silent_mutation	Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406994122	NA	1.86E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	5.09E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	7.48E-06	8.04E-07	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	3.72E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	4.03E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	2.09E-07	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	8.67E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	6.97E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	5.67E-06	2.41E-08	mr1649	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	5.97E-09	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	2.52E-06	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	4.87E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	6.16E-06	6.16E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	1.52E-06	1.52E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	9.31E-06	mr1833	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122	NA	1.61E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251