\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406994122:

Variant ID: vg0406994122 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6994122
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.21, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CTAGAAAAGAAAAAATAACCACCAGCTGGCTGAACAGCTACACAGCACACGCCACAACTCACTAACAACTGAAACACTGACGGAGCCCAACGTAGGGTGT[C/T]
GTTACCAAGCTTGACCGAAAACAACATAGGGGGTTTGGACTTTGCAAACGTGTCATCGTTGCCAGGCTTGCTGCCAAGCGACACAGCAGCTCCGACTTCA

Reverse complement sequence

TGAAGTCGGAGCTGCTGTGTCGCTTGGCAGCAAGCCTGGCAACGATGACACGTTTGCAAAGTCCAAACCCCCTATGTTGTTTTCGGTCAAGCTTGGTAAC[G/A]
ACACCCTACGTTGGGCTCCGTCAGTGTTTCAGTTGTTAGTGAGTTGTGGCGTGTGCTGTGTAGCTGTTCAGCCAGCTGGTGGTTATTTTTTCTTTTCTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 16.20% 0.40% 18.18% NA
All Indica  2759 78.90% 20.70% 0.00% 0.36% NA
All Japonica  1512 44.00% 0.60% 1.19% 54.23% NA
Aus  269 39.80% 60.20% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.00% 0.17% NA
Indica II  465 85.80% 13.50% 0.00% 0.65% NA
Indica III  913 67.50% 32.30% 0.00% 0.22% NA
Indica Intermediate  786 75.40% 24.00% 0.00% 0.51% NA
Temperate Japonica  767 57.50% 0.50% 1.43% 40.55% NA
Tropical Japonica  504 11.90% 0.80% 1.19% 86.11% NA
Japonica Intermediate  241 68.00% 0.40% 0.41% 31.12% NA
VI/Aromatic  96 76.00% 9.40% 0.00% 14.58% NA
Intermediate  90 67.80% 14.40% 1.11% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406994122 C -> DEL N N silent_mutation Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0406994122 C -> T LOC_Os04g12620.1 downstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0406994122 C -> T LOC_Os04g12639.1 downstream_gene_variant ; 2741.0bp to feature; MODIFIER silent_mutation Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N
vg0406994122 C -> T LOC_Os04g12610-LOC_Os04g12620 intergenic_region ; MODIFIER silent_mutation Average:48.586; most accessible tissue: Zhenshan97 young leaf, score: 63.096 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406994122 NA 1.86E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 5.09E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 7.48E-06 8.04E-07 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 3.72E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 4.03E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 2.09E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 8.67E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 6.97E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 5.67E-06 2.41E-08 mr1649 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 5.97E-09 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 2.52E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 4.87E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 6.16E-06 6.16E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 1.52E-06 1.52E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 9.31E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406994122 NA 1.61E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251