Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406993809:

Variant ID: vg0406993809 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6993809
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CCGCTCTTGCTATTCGTGGGGTGCGAGGGTAGGGCCAGGCTGTAGGGTCACGCGACAGGATGGGAAGGTAAATTCCCCTCACTTCGCATACCCCTGGGCC[C/T]
ATGTCTCCGACATTATCCAACATTTTATTTGTGTGTAGGACCCAACAACTAATAATCGGTGGATAGGAGCTGGACTGAAAAGATATCACAGCCATGCAAG

Reverse complement sequence

CTTGCATGGCTGTGATATCTTTTCAGTCCAGCTCCTATCCACCGATTATTAGTTGTTGGGTCCTACACACAAATAAAATGTTGGATAATGTCGGAGACAT[G/A]
GGCCCAGGGGTATGCGAAGTGAGGGGAATTTACCTTCCCATCCTGTCGCGTGACCCTACAGCCTGGCCCTACCCTCGCACCCCACGAATAGCAAGAGCGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	4.80%	0.66%	18.05%	NA
All Indica	2759	91.70%	7.90%	0.04%	0.36%	NA
All Japonica	1512	44.00%	0.30%	1.85%	53.84%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.00%	0.17%	NA
Indica II	465	90.50%	8.80%	0.00%	0.65%	NA
Indica III	913	96.50%	3.30%	0.00%	0.22%	NA
Indica Intermediate	786	84.00%	15.40%	0.13%	0.51%	NA
Temperate Japonica	767	56.70%	0.40%	3.13%	39.77%	NA
Tropical Japonica	504	13.10%	0.40%	0.79%	85.71%	NA
Japonica Intermediate	241	68.00%	0.00%	0.00%	31.95%	NA
VI/Aromatic	96	85.40%	0.00%	0.00%	14.58%	NA
Intermediate	90	74.40%	6.70%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406993809	C -> DEL	N	N	silent_mutation	Average:65.197; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0406993809	C -> T	LOC_Os04g12620.1	downstream_gene_variant ; 538.0bp to feature; MODIFIER	silent_mutation	Average:65.197; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0406993809	C -> T	LOC_Os04g12639.1	downstream_gene_variant ; 3054.0bp to feature; MODIFIER	silent_mutation	Average:65.197; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N
vg0406993809	C -> T	LOC_Os04g12610-LOC_Os04g12620	intergenic_region ; MODIFIER	silent_mutation	Average:65.197; most accessible tissue: Minghui63 young leaf, score: 80.883	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406993809	NA	3.81E-07	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406993809	NA	2.31E-07	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406993809	9.79E-07	9.79E-07	mr1340	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406993809	7.10E-06	7.10E-06	mr1429	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406993809	NA	3.20E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406993809	4.75E-06	4.75E-06	mr1964	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406993809	NA	9.33E-06	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251