\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406987146:

Variant ID: vg0406987146 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6987146
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, T: 0.19, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCAAGGAAGTGAGAAGTTTTGCTGAATCTTATGATATTAGGTTGTTGAGTTCTTCTCTTTACTACGCTCAGGCTAATGGATAAGCCGAGTCGAGTAAT[A/T]
AAACATTGTTGAAATTGTCGTTTTGCCAGTTGAGGTAAATCTTGGCTCTCTTTGGTATTTCAAGCTAGACGACTTGTCGGTTGGAGATTACAAGACCTTG

Reverse complement sequence

CAAGGTCTTGTAATCTCCAACCGACAAGTCGTCTAGCTTGAAATACCAAAGAGAGCCAAGATTTACCTCAACTGGCAAAACGACAATTTCAACAATGTTT[T/A]
ATTACTCGACTCGGCTTATCCATTAGCCTGAGCGTAGTAAAGAGAAGAACTCAACAACCTAATATCATAAGATTCAGCAAAACTTCTCACTTCCTTGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 15.20% 0.74% 17.44% NA
All Indica  2759 80.60% 19.10% 0.04% 0.25% NA
All Japonica  1512 45.10% 0.60% 1.98% 52.31% NA
Aus  269 40.10% 59.90% 0.00% 0.00% NA
Indica I  595 95.60% 4.20% 0.00% 0.17% NA
Indica II  465 86.90% 12.70% 0.00% 0.43% NA
Indica III  913 70.60% 29.20% 0.11% 0.00% NA
Indica Intermediate  786 77.10% 22.40% 0.00% 0.51% NA
Temperate Japonica  767 57.90% 0.50% 1.83% 39.77% NA
Tropical Japonica  504 14.30% 0.80% 2.78% 82.14% NA
Japonica Intermediate  241 68.90% 0.40% 0.83% 29.88% NA
VI/Aromatic  96 77.10% 8.30% 1.04% 13.54% NA
Intermediate  90 67.80% 14.40% 3.33% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406987146 A -> DEL N N silent_mutation Average:24.738; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg0406987146 A -> T LOC_Os04g12610.1 intron_variant ; MODIFIER silent_mutation Average:24.738; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406987146 2.39E-06 2.39E-06 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 1.38E-06 1.35E-08 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 3.04E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 1.63E-06 1.07E-07 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 8.01E-06 8.01E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 8.29E-06 1.11E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 4.33E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 6.91E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 8.49E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 1.15E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 7.00E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 1.61E-08 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 5.19E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 3.78E-06 4.61E-07 mr1537 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 2.69E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 2.41E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 8.30E-06 3.17E-08 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 2.43E-09 mr1665 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 2.14E-06 3.97E-07 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 4.94E-07 4.94E-07 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 1.76E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 4.18E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 9.99E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 6.66E-09 6.66E-09 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 2.44E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 7.36E-06 7.36E-06 mr1894 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 8.45E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146 NA 6.76E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251