Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406987146:

Variant ID: vg0406987146 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6987146
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, T: 0.19, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTCCAAGGAAGTGAGAAGTTTTGCTGAATCTTATGATATTAGGTTGTTGAGTTCTTCTCTTTACTACGCTCAGGCTAATGGATAAGCCGAGTCGAGTAAT[A/T]
AAACATTGTTGAAATTGTCGTTTTGCCAGTTGAGGTAAATCTTGGCTCTCTTTGGTATTTCAAGCTAGACGACTTGTCGGTTGGAGATTACAAGACCTTG

Reverse complement sequence

CAAGGTCTTGTAATCTCCAACCGACAAGTCGTCTAGCTTGAAATACCAAAGAGAGCCAAGATTTACCTCAACTGGCAAAACGACAATTTCAACAATGTTT[T/A]
ATTACTCGACTCGGCTTATCCATTAGCCTGAGCGTAGTAAAGAGAAGAACTCAACAACCTAATATCATAAGATTCAGCAAAACTTCTCACTTCCTTGGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	15.20%	0.74%	17.44%	NA
All Indica	2759	80.60%	19.10%	0.04%	0.25%	NA
All Japonica	1512	45.10%	0.60%	1.98%	52.31%	NA
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.00%	0.17%	NA
Indica II	465	86.90%	12.70%	0.00%	0.43%	NA
Indica III	913	70.60%	29.20%	0.11%	0.00%	NA
Indica Intermediate	786	77.10%	22.40%	0.00%	0.51%	NA
Temperate Japonica	767	57.90%	0.50%	1.83%	39.77%	NA
Tropical Japonica	504	14.30%	0.80%	2.78%	82.14%	NA
Japonica Intermediate	241	68.90%	0.40%	0.83%	29.88%	NA
VI/Aromatic	96	77.10%	8.30%	1.04%	13.54%	NA
Intermediate	90	67.80%	14.40%	3.33%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406987146	A -> DEL	N	N	silent_mutation	Average:24.738; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N
vg0406987146	A -> T	LOC_Os04g12610.1	intron_variant ; MODIFIER	silent_mutation	Average:24.738; most accessible tissue: Minghui63 young leaf, score: 36.684	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406987146	2.39E-06	2.39E-06	mr1054	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	1.38E-06	1.35E-08	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	3.04E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	1.63E-06	1.07E-07	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	8.01E-06	8.01E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	8.29E-06	1.11E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	4.33E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	6.91E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	8.49E-06	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	1.15E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	7.00E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	1.61E-08	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	5.19E-06	mr1516	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	3.78E-06	4.61E-07	mr1537	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	2.69E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	2.41E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	8.30E-06	3.17E-08	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	2.43E-09	mr1665	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	2.14E-06	3.97E-07	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	4.94E-07	4.94E-07	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	1.76E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	4.18E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	9.99E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	6.66E-09	6.66E-09	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	2.44E-06	mr1833	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	7.36E-06	7.36E-06	mr1894	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	8.45E-06	mr1976	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987146	NA	6.76E-06	mr1976	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251