\
| Variant ID: vg0406961183 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6961183 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, G: 0.16, others allele: 0.00, population size: 107. )
GCTATATAAACGATCCTCGTGATCCCCTCCTCCCTTTCCCTCTTCTGCCGCTCGTTCCCGTCTTTCTCGAAGTGGTTGTAGAGGTTCAAGTAGCGCGGAG[C/G]
AAGGCAAGCCATGCATCCCTCATTGAACATATTATACCTATATTGCAAATGTCTCGCTTTCTTATTTTATAATGTCAGAATTATCCGTTATAACATAAGG
CCTTATGTTATAACGGATAATTCTGACATTATAAAATAAGAAAGCGAGACATTTGCAATATAGGTATAATATGTTCAATGAGGGATGCATGGCTTGCCTT[G/C]
CTCCGCGCTACTTGAACCTCTACAACCACTTCGAGAAAGACGGGAACGAGCGGCAGAAGAGGGAAAGGGAGGAGGGGATCACGAGGATCGTTTATATAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 24.30% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 63.30% | 36.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 70.60% | 29.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 81.50% | 18.20% | 0.34% | 0.00% | NA |
| Indica II | 465 | 38.30% | 61.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 59.60% | 40.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 68.70% | 31.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 22.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406961183 | C -> G | LOC_Os04g12560.1 | upstream_gene_variant ; 3259.0bp to feature; MODIFIER | silent_mutation | Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0406961183 | C -> G | LOC_Os04g12570.1 | upstream_gene_variant ; 1564.0bp to feature; MODIFIER | silent_mutation | Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| vg0406961183 | C -> G | LOC_Os04g12570-LOC_Os04g12580 | intergenic_region ; MODIFIER | silent_mutation | Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406961183 | NA | 2.98E-07 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | 4.67E-06 | 4.65E-06 | mr1012 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 5.85E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 1.75E-10 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 1.54E-10 | mr1608 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 8.10E-09 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 1.65E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 5.86E-08 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 2.44E-12 | mr1830_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | NA | 3.07E-10 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | 3.16E-06 | 3.34E-18 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406961183 | 7.26E-07 | 3.72E-17 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |