Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406961183:

Variant ID: vg0406961183 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6961183
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, G: 0.16, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GCTATATAAACGATCCTCGTGATCCCCTCCTCCCTTTCCCTCTTCTGCCGCTCGTTCCCGTCTTTCTCGAAGTGGTTGTAGAGGTTCAAGTAGCGCGGAG[C/G]
AAGGCAAGCCATGCATCCCTCATTGAACATATTATACCTATATTGCAAATGTCTCGCTTTCTTATTTTATAATGTCAGAATTATCCGTTATAACATAAGG

Reverse complement sequence

CCTTATGTTATAACGGATAATTCTGACATTATAAAATAAGAAAGCGAGACATTTGCAATATAGGTATAATATGTTCAATGAGGGATGCATGGCTTGCCTT[G/C]
CTCCGCGCTACTTGAACCTCTACAACCACTTCGAGAAAGACGGGAACGAGCGGCAGAAGAGGGAAAGGGAGGAGGGGATCACGAGGATCGTTTATATAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	24.30%	0.13%	0.00%	NA
All Indica	2759	63.30%	36.50%	0.14%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	70.60%	29.00%	0.37%	0.00%	NA
Indica I	595	81.50%	18.20%	0.34%	0.00%	NA
Indica II	465	38.30%	61.50%	0.22%	0.00%	NA
Indica III	913	59.60%	40.40%	0.00%	0.00%	NA
Indica Intermediate	786	68.70%	31.20%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406961183	C -> G	LOC_Os04g12560.1	upstream_gene_variant ; 3259.0bp to feature; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0406961183	C -> G	LOC_Os04g12570.1	upstream_gene_variant ; 1564.0bp to feature; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0406961183	C -> G	LOC_Os04g12570-LOC_Os04g12580	intergenic_region ; MODIFIER	silent_mutation	Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406961183	NA	2.98E-07	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	4.67E-06	4.65E-06	mr1012	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	5.85E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	1.75E-10	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	1.54E-10	mr1608	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	8.10E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	1.65E-06	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	5.86E-08	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	2.44E-12	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	NA	3.07E-10	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	3.16E-06	3.34E-18	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183	7.26E-07	3.72E-17	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251