\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406961183:

Variant ID: vg0406961183 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6961183
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, G: 0.16, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCTATATAAACGATCCTCGTGATCCCCTCCTCCCTTTCCCTCTTCTGCCGCTCGTTCCCGTCTTTCTCGAAGTGGTTGTAGAGGTTCAAGTAGCGCGGAG[C/G]
AAGGCAAGCCATGCATCCCTCATTGAACATATTATACCTATATTGCAAATGTCTCGCTTTCTTATTTTATAATGTCAGAATTATCCGTTATAACATAAGG

Reverse complement sequence

CCTTATGTTATAACGGATAATTCTGACATTATAAAATAAGAAAGCGAGACATTTGCAATATAGGTATAATATGTTCAATGAGGGATGCATGGCTTGCCTT[G/C]
CTCCGCGCTACTTGAACCTCTACAACCACTTCGAGAAAGACGGGAACGAGCGGCAGAAGAGGGAAAGGGAGGAGGGGATCACGAGGATCGTTTATATAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.30% 0.13% 0.00% NA
All Indica  2759 63.30% 36.50% 0.14% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 70.60% 29.00% 0.37% 0.00% NA
Indica I  595 81.50% 18.20% 0.34% 0.00% NA
Indica II  465 38.30% 61.50% 0.22% 0.00% NA
Indica III  913 59.60% 40.40% 0.00% 0.00% NA
Indica Intermediate  786 68.70% 31.20% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406961183 C -> G LOC_Os04g12560.1 upstream_gene_variant ; 3259.0bp to feature; MODIFIER silent_mutation Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056 N N N N
vg0406961183 C -> G LOC_Os04g12570.1 upstream_gene_variant ; 1564.0bp to feature; MODIFIER silent_mutation Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056 N N N N
vg0406961183 C -> G LOC_Os04g12570-LOC_Os04g12580 intergenic_region ; MODIFIER silent_mutation Average:56.913; most accessible tissue: Zhenshan97 young leaf, score: 80.056 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406961183 NA 2.98E-07 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 4.67E-06 4.65E-06 mr1012 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 5.85E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 1.75E-10 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 1.54E-10 mr1608 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 8.10E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 1.65E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 5.86E-08 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 2.44E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 NA 3.07E-10 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 3.16E-06 3.34E-18 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406961183 7.26E-07 3.72E-17 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251