Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406960696:

Variant ID: vg0406960696 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6960696
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ACTGACGGGCAGGCCCACTTACACATACTATCCAACTTAAACTTTCATCCCCGTTTCGTGTAAAAGGGTTAACCCAGGAGTGATATGGTTGGAAGGACAA[G/A]
CCCTTATAAGTTGGTTCCACTCTTGCTAAACTAGCAAGGTGGTACTAAACGAGCGCACACAACACTCATAGGTCACAAAGGTCTCATCCTAATTGGGCCA

Reverse complement sequence

TGGCCCAATTAGGATGAGACCTTTGTGACCTATGAGTGTTGTGTGCGCTCGTTTAGTACCACCTTGCTAGTTTAGCAAGAGTGGAACCAACTTATAAGGG[C/T]
TTGTCCTTCCAACCATATCACTCCTGGGTTAACCCTTTTACACGAAACGGGGATGAAAGTTTAAGTTGGATAGTATGTGTAAGTGGGCCTGCCCGTCAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.30%	17.60%	0.06%	0.00%	NA
All Indica	2759	74.70%	25.20%	0.11%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	70.60%	29.40%	0.00%	0.00%	NA
Indica I	595	81.80%	17.80%	0.34%	0.00%	NA
Indica II	465	62.60%	37.40%	0.00%	0.00%	NA
Indica III	913	75.80%	24.20%	0.00%	0.00%	NA
Indica Intermediate	786	75.20%	24.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	66.70%	33.30%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406960696	G -> A	LOC_Os04g12560.1	upstream_gene_variant ; 2772.0bp to feature; MODIFIER	silent_mutation	Average:71.044; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N
vg0406960696	G -> A	LOC_Os04g12570.1	upstream_gene_variant ; 1077.0bp to feature; MODIFIER	silent_mutation	Average:71.044; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N
vg0406960696	G -> A	LOC_Os04g12570-LOC_Os04g12580	intergenic_region ; MODIFIER	silent_mutation	Average:71.044; most accessible tissue: Zhenshan97 young leaf, score: 85.364	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406960696	NA	7.87E-08	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	6.38E-06	mr1011	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	3.18E-06	3.17E-06	mr1012	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	4.31E-08	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	6.46E-10	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	1.65E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	2.27E-08	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	2.28E-08	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	1.62E-09	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	4.19E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	4.39E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	4.04E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	3.32E-09	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	4.66E-09	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	2.00E-13	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	1.36E-11	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	NA	2.78E-18	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960696	4.77E-06	1.39E-16	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251