Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406944785:

Variant ID: vg0406944785 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6944785
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAATTGCAACAAATTTAATGGTGTAATCGGATCATGATTTGGATAAGTAGTTTAAGAGAAAAATCAATTTAAAGTTGTTTTGCACGTATACGTGGCG[T/C]
TGACGGCGCTGACGTCGTGCTGACGTCAGTGCCCGATTTTAACCCCCCATCGGGCGCCCGTGCCGAAGTCATTCCCGTATGTAACACATACTAGTATAAT

Reverse complement sequence

ATTATACTAGTATGTGTTACATACGGGAATGACTTCGGCACGGGCGCCCGATGGGGGGTTAAAATCGGGCACTGACGTCAGCACGACGTCAGCGCCGTCA[A/G]
CGCCACGTATACGTGCAAAACAACTTTAAATTGATTTTTCTCTTAAACTACTTATCCAAATCATGATCCGATTACACCATTAAATTTGTTGCAATTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 1.50% 1.18% 3.94% NA
All Indica  2759 90.50% 2.40% 1.78% 5.26% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.13% NA
Aus  269 88.50% 0.70% 2.23% 8.55% NA
Indica I  595 92.30% 2.00% 1.34% 4.37% NA
Indica II  465 92.00% 1.90% 2.37% 3.66% NA
Indica III  913 88.80% 3.40% 1.31% 6.46% NA
Indica Intermediate  786 90.30% 1.90% 2.29% 5.47% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 86.50% 0.00% 1.04% 12.50% NA
Intermediate  90 91.10% 4.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406944785 T -> C LOC_Os04g12540.1 upstream_gene_variant ; 2069.0bp to feature; MODIFIER silent_mutation Average:52.28; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0406944785 T -> C LOC_Os04g12540-LOC_Os04g12550 intergenic_region ; MODIFIER silent_mutation Average:52.28; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0406944785 T -> DEL N N silent_mutation Average:52.28; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406944785 9.83E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 4.78E-11 1.29E-14 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 2.68E-09 1.37E-12 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.47E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.53E-32 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 3.65E-09 7.04E-11 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 2.91E-19 mr1156 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 8.64E-22 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.17E-14 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 9.31E-10 1.80E-12 mr1203 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 6.07E-24 mr1264 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.27E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.20E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 2.43E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 8.98E-08 4.95E-10 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.63E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 2.98E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 4.97E-07 1.91E-08 mr1613 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 4.45E-09 1.99E-11 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 3.79E-06 3.08E-08 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 6.23E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.08E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 4.02E-20 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.29E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 4.30E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 2.36E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.05E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 6.21E-08 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.76E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 3.65E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 3.74E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 4.19E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 7.90E-10 2.63E-16 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 1.79E-08 3.39E-15 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.21E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 1.03E-10 1.50E-16 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 5.05E-08 8.83E-13 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 3.60E-06 2.00E-10 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944785 NA 1.23E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251