Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406944478:

Variant ID: vg0406944478 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6944478
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCTCTATTAAGGGAATTCGTTTTATTTTTTGTTCGACTAAAAATGTTTCACCTAGTGTACTCACAATGTTTCACTATGTATAGATCTAATGTTGTAGT[A/G]
AACTAAAACATTCTTTCGCTATTTGTTGAAACATTGTTTTTATATAAGGTGAAACAACACCCGATTTAAACGGGTGAAACATTTTCGATCTACGTAGTGA

Reverse complement sequence

TCACTACGTAGATCGAAAATGTTTCACCCGTTTAAATCGGGTGTTGTTTCACCTTATATAAAAACAATGTTTCAACAAATAGCGAAAGAATGTTTTAGTT[T/C]
ACTACAACATTAGATCTATACATAGTGAAACATTGTGAGTACACTAGGTGAAACATTTTTAGTCGAACAAAAAATAAAACGAATTCCCTTAATAGAGGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 0.20% 15.19% 36.25% NA
All Indica  2759 17.20% 0.30% 24.68% 57.81% NA
All Japonica  1512 99.30% 0.00% 0.20% 0.53% NA
Aus  269 71.00% 0.00% 6.69% 22.30% NA
Indica I  595 2.00% 0.30% 12.27% 85.38% NA
Indica II  465 8.60% 0.40% 48.39% 42.58% NA
Indica III  913 34.70% 0.00% 19.50% 45.78% NA
Indica Intermediate  786 13.40% 0.60% 26.08% 59.92% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 99.20% 0.00% 0.20% 0.60% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 67.70% 0.00% 5.21% 27.08% NA
Intermediate  90 61.10% 0.00% 12.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406944478 A -> DEL N N silent_mutation Average:21.394; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0406944478 A -> G LOC_Os04g12540.1 upstream_gene_variant ; 1762.0bp to feature; MODIFIER silent_mutation Average:21.394; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0406944478 A -> G LOC_Os04g12540-LOC_Os04g12550 intergenic_region ; MODIFIER silent_mutation Average:21.394; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406944478 2.30E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 1.13E-10 8.84E-14 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 3.89E-08 2.89E-11 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 1.78E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 7.65E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 2.53E-08 4.48E-10 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 6.87E-17 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 1.72E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 9.50E-09 2.93E-11 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 1.62E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 9.75E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 1.17E-07 2.13E-09 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 3.82E-06 4.20E-08 mr1613 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 1.40E-07 1.20E-09 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 2.19E-07 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 6.14E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 2.07E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 1.39E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 3.77E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 2.62E-13 1.86E-19 mr1071_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 3.90E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 1.16E-12 2.65E-18 mr1080_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 3.09E-07 3.07E-10 mr1100_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 1.87E-14 5.69E-20 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 7.60E-11 8.90E-16 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 1.67E-08 1.25E-12 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 6.05E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 1.74E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944478 NA 6.76E-06 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251