\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406944392:

Variant ID: vg0406944392 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6944392
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CACTCACAATGTTTCACTATGTATATATCTAATGTTGCAGTGAACTGAAATACTCTATTGCAACAAATCACCCACATATTTTGGAAACCCTCTATTAAGG[G/A]
AATTCGTTTTATTTTTTGTTCGACTAAAAATGTTTCACCTAGTGTACTCACAATGTTTCACTATGTATAGATCTAATGTTGTAGTAAACTAAAACATTCT

Reverse complement sequence

AGAATGTTTTAGTTTACTACAACATTAGATCTATACATAGTGAAACATTGTGAGTACACTAGGTGAAACATTTTTAGTCGAACAAAAAATAAAACGAATT[C/T]
CCTTAATAGAGGGTTTCCAAAATATGTGGGTGATTTGTTGCAATAGAGTATTTCAGTTCACTGCAACATTAGATATATACATAGTGAAACATTGTGAGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 32.70% 17.12% 2.26% NA
All Indica  2759 16.50% 50.90% 28.74% 3.88% NA
All Japonica  1512 99.30% 0.60% 0.13% 0.00% NA
Aus  269 70.60% 28.30% 1.12% 0.00% NA
Indica I  595 1.70% 43.50% 47.90% 6.89% NA
Indica II  465 7.50% 59.10% 31.61% 1.72% NA
Indica III  913 34.40% 48.10% 13.80% 3.72% NA
Indica Intermediate  786 12.10% 55.00% 29.90% 3.05% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 31.20% 1.04% 0.00% NA
Intermediate  90 60.00% 28.90% 11.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406944392 G -> DEL N N silent_mutation Average:21.106; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0406944392 G -> A LOC_Os04g12540.1 upstream_gene_variant ; 1676.0bp to feature; MODIFIER silent_mutation Average:21.106; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0406944392 G -> A LOC_Os04g12540-LOC_Os04g12550 intergenic_region ; MODIFIER silent_mutation Average:21.106; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406944392 2.05E-06 8.07E-08 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 2.68E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 3.43E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 2.04E-19 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 2.12E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 7.24E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 1.78E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 3.29E-10 8.22E-13 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 2.89E-09 2.72E-11 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 1.85E-09 5.59E-12 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 3.56E-09 2.10E-10 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 1.88E-06 5.63E-08 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 2.94E-34 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406944392 NA 9.97E-07 mr1913_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251