\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406888783:

Variant ID: vg0406888783 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6888783
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATGGGAGGGCAATGCCACCATGTGCGCCACCCCCGTCCACGTCATGTGCCATCCCACACGCCAAGCATGCCACGCAACTAGACGCACTCCGGCTTGA[G/A]
CCAGCAAGCCACAAGCAAATACAGACGCAACAAGACAAGGAAAAAAAACAGAAAAAAAAAAAGAACCAACAAGAAATGTTCCATCAGAAATAGACTTCAA

Reverse complement sequence

TTGAAGTCTATTTCTGATGGAACATTTCTTGTTGGTTCTTTTTTTTTTTCTGTTTTTTTTCCTTGTCTTGTTGCGTCTGTATTTGCTTGTGGCTTGCTGG[C/T]
TCAAGCCGGAGTGCGTCTAGTTGCGTGGCATGCTTGGCGTGTGGGATGGCACATGACGTGGACGGGGGTGGCGCACATGGTGGCATTGCCCTCCCATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.60% 41.80% 0.34% 10.28% NA
All Indica  2759 24.50% 61.50% 0.51% 13.48% NA
All Japonica  1512 99.10% 0.50% 0.00% 0.40% NA
Aus  269 1.50% 70.60% 0.37% 27.51% NA
Indica I  595 7.20% 74.60% 0.50% 17.65% NA
Indica II  465 20.00% 77.60% 0.65% 1.72% NA
Indica III  913 35.80% 47.50% 0.66% 15.99% NA
Indica Intermediate  786 27.10% 58.30% 0.25% 14.38% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 97.10% 1.70% 0.00% 1.24% NA
VI/Aromatic  96 18.80% 52.10% 1.04% 28.12% NA
Intermediate  90 57.80% 34.40% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406888783 G -> DEL N N silent_mutation Average:46.383; most accessible tissue: Minghui63 root, score: 83.674 N N N N
vg0406888783 G -> A LOC_Os04g12460.1 downstream_gene_variant ; 243.0bp to feature; MODIFIER silent_mutation Average:46.383; most accessible tissue: Minghui63 root, score: 83.674 N N N N
vg0406888783 G -> A LOC_Os04g12450-LOC_Os04g12460 intergenic_region ; MODIFIER silent_mutation Average:46.383; most accessible tissue: Minghui63 root, score: 83.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406888783 1.31E-06 1.31E-06 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 NA 5.93E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 3.01E-06 3.01E-06 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 6.55E-06 7.94E-07 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 NA 9.69E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 4.16E-06 4.16E-06 mr1643 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 NA 2.14E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 5.97E-06 5.97E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 1.02E-06 1.02E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 NA 1.47E-08 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888783 NA 7.32E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251