\
| Variant ID: vg0406888783 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6888783 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, others allele: 0.00, population size: 92. )
ATCATGGGAGGGCAATGCCACCATGTGCGCCACCCCCGTCCACGTCATGTGCCATCCCACACGCCAAGCATGCCACGCAACTAGACGCACTCCGGCTTGA[G/A]
CCAGCAAGCCACAAGCAAATACAGACGCAACAAGACAAGGAAAAAAAACAGAAAAAAAAAAAGAACCAACAAGAAATGTTCCATCAGAAATAGACTTCAA
TTGAAGTCTATTTCTGATGGAACATTTCTTGTTGGTTCTTTTTTTTTTTCTGTTTTTTTTCCTTGTCTTGTTGCGTCTGTATTTGCTTGTGGCTTGCTGG[C/T]
TCAAGCCGGAGTGCGTCTAGTTGCGTGGCATGCTTGGCGTGTGGGATGGCACATGACGTGGACGGGGGTGGCGCACATGGTGGCATTGCCCTCCCATGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.60% | 41.80% | 0.34% | 10.28% | NA |
| All Indica | 2759 | 24.50% | 61.50% | 0.51% | 13.48% | NA |
| All Japonica | 1512 | 99.10% | 0.50% | 0.00% | 0.40% | NA |
| Aus | 269 | 1.50% | 70.60% | 0.37% | 27.51% | NA |
| Indica I | 595 | 7.20% | 74.60% | 0.50% | 17.65% | NA |
| Indica II | 465 | 20.00% | 77.60% | 0.65% | 1.72% | NA |
| Indica III | 913 | 35.80% | 47.50% | 0.66% | 15.99% | NA |
| Indica Intermediate | 786 | 27.10% | 58.30% | 0.25% | 14.38% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.70% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 18.80% | 52.10% | 1.04% | 28.12% | NA |
| Intermediate | 90 | 57.80% | 34.40% | 0.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406888783 | G -> DEL | N | N | silent_mutation | Average:46.383; most accessible tissue: Minghui63 root, score: 83.674 | N | N | N | N |
| vg0406888783 | G -> A | LOC_Os04g12460.1 | downstream_gene_variant ; 243.0bp to feature; MODIFIER | silent_mutation | Average:46.383; most accessible tissue: Minghui63 root, score: 83.674 | N | N | N | N |
| vg0406888783 | G -> A | LOC_Os04g12450-LOC_Os04g12460 | intergenic_region ; MODIFIER | silent_mutation | Average:46.383; most accessible tissue: Minghui63 root, score: 83.674 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406888783 | 1.31E-06 | 1.31E-06 | mr1054 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | NA | 5.93E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | 3.01E-06 | 3.01E-06 | mr1287 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | 6.55E-06 | 7.94E-07 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | NA | 9.69E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | 4.16E-06 | 4.16E-06 | mr1643 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | NA | 2.14E-06 | mr1665 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | 5.97E-06 | 5.97E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | 1.02E-06 | 1.02E-06 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | NA | 1.47E-08 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888783 | NA | 7.32E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |