\
| Variant ID: vg0406888519 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6888519 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 97. )
CACAATTTTTGAAATATAGTATGAATAATCCGGTTGATGGTATATAAGTCTCTAAAGCTGACAATAAGATACACGCCCGCACATTTGCGTGGGTTACCTT[T/C]
CTAGTCTAATTTAAGAAACTGTTGGGAACAAACTCGATACAAATTGGTAAAACACCTGGAGAATATAATAATAAACAAACTCGACAAAGACAGGGTTTTG
CAAAACCCTGTCTTTGTCGAGTTTGTTTATTATTATATTCTCCAGGTGTTTTACCAATTTGTATCGAGTTTGTTCCCAACAGTTTCTTAAATTAGACTAG[A/G]
AAGGTAACCCACGCAAATGTGCGGGCGTGTATCTTATTGTCAGCTTTAGAGACTTATATACCATCAACCGGATTATTCATACTATATTTCAAAAATTGTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.20% | 6.10% | 10.71% | 34.96% | NA |
| All Indica | 2759 | 25.40% | 8.60% | 17.29% | 48.64% | NA |
| All Japonica | 1512 | 99.10% | 0.20% | 0.00% | 0.66% | NA |
| Aus | 269 | 2.20% | 1.90% | 6.69% | 89.22% | NA |
| Indica I | 595 | 8.40% | 8.40% | 14.79% | 68.40% | NA |
| Indica II | 465 | 21.30% | 5.20% | 21.29% | 52.26% | NA |
| Indica III | 913 | 36.70% | 11.10% | 16.32% | 35.93% | NA |
| Indica Intermediate | 786 | 27.70% | 8.00% | 17.94% | 46.31% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 18.80% | 36.50% | 5.21% | 39.58% | NA |
| Intermediate | 90 | 58.90% | 10.00% | 6.67% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406888519 | T -> C | LOC_Os04g12460.1 | downstream_gene_variant ; 507.0bp to feature; MODIFIER | silent_mutation | Average:40.054; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
| vg0406888519 | T -> C | LOC_Os04g12450-LOC_Os04g12460 | intergenic_region ; MODIFIER | silent_mutation | Average:40.054; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
| vg0406888519 | T -> DEL | N | N | silent_mutation | Average:40.054; most accessible tissue: Minghui63 root, score: 78.091 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406888519 | 2.31E-06 | 2.31E-06 | mr1054 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | NA | 3.48E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | 6.20E-06 | 6.19E-06 | mr1287 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | 7.28E-06 | 1.31E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | NA | 2.25E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | 9.77E-06 | 9.77E-06 | mr1643 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | NA | 1.88E-06 | mr1665 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | 5.01E-07 | 5.01E-07 | mr1687 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | 7.13E-07 | 7.13E-07 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | NA | 3.96E-06 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406888519 | NA | 4.50E-06 | mr1913 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |