\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406888519:

Variant ID: vg0406888519 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6888519
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.89, C: 0.11, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CACAATTTTTGAAATATAGTATGAATAATCCGGTTGATGGTATATAAGTCTCTAAAGCTGACAATAAGATACACGCCCGCACATTTGCGTGGGTTACCTT[T/C]
CTAGTCTAATTTAAGAAACTGTTGGGAACAAACTCGATACAAATTGGTAAAACACCTGGAGAATATAATAATAAACAAACTCGACAAAGACAGGGTTTTG

Reverse complement sequence

CAAAACCCTGTCTTTGTCGAGTTTGTTTATTATTATATTCTCCAGGTGTTTTACCAATTTGTATCGAGTTTGTTCCCAACAGTTTCTTAAATTAGACTAG[A/G]
AAGGTAACCCACGCAAATGTGCGGGCGTGTATCTTATTGTCAGCTTTAGAGACTTATATACCATCAACCGGATTATTCATACTATATTTCAAAAATTGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.20% 6.10% 10.71% 34.96% NA
All Indica  2759 25.40% 8.60% 17.29% 48.64% NA
All Japonica  1512 99.10% 0.20% 0.00% 0.66% NA
Aus  269 2.20% 1.90% 6.69% 89.22% NA
Indica I  595 8.40% 8.40% 14.79% 68.40% NA
Indica II  465 21.30% 5.20% 21.29% 52.26% NA
Indica III  913 36.70% 11.10% 16.32% 35.93% NA
Indica Intermediate  786 27.70% 8.00% 17.94% 46.31% NA
Temperate Japonica  767 99.70% 0.00% 0.00% 0.26% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 97.10% 1.20% 0.00% 1.66% NA
VI/Aromatic  96 18.80% 36.50% 5.21% 39.58% NA
Intermediate  90 58.90% 10.00% 6.67% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406888519 T -> C LOC_Os04g12460.1 downstream_gene_variant ; 507.0bp to feature; MODIFIER silent_mutation Average:40.054; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0406888519 T -> C LOC_Os04g12450-LOC_Os04g12460 intergenic_region ; MODIFIER silent_mutation Average:40.054; most accessible tissue: Minghui63 root, score: 78.091 N N N N
vg0406888519 T -> DEL N N silent_mutation Average:40.054; most accessible tissue: Minghui63 root, score: 78.091 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406888519 2.31E-06 2.31E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 NA 3.48E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 6.20E-06 6.19E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 7.28E-06 1.31E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 NA 2.25E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 9.77E-06 9.77E-06 mr1643 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 NA 1.88E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 5.01E-07 5.01E-07 mr1687 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 7.13E-07 7.13E-07 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 NA 3.96E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406888519 NA 4.50E-06 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251