\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406880594:

Variant ID: vg0406880594 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6880594
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCGGCCGCCGTTGGAGCACCACCGCTATCTCGCCTCCGTCCGGTGCCGTGCCGCTTGGTGAGCATCTGTAACACCCTGAAAATTCGACCAATAAAAA[C/T,A]
AAAACTCTAAAAATACGGACCTTCGAAAACTTTTTAAATTAATTGCATCATGCCAATTTTATTCGCCTATTTTATTTGGATTTGATTTCGAAGTTCATTA

Reverse complement sequence

TAATGAACTTCGAAATCAAATCCAAATAAAATAGGCGAATAAAATTGGCATGATGCAATTAATTTAAAAAGTTTTCGAAGGTCCGTATTTTTAGAGTTTT[G/A,T]
TTTTTATTGGTCGAATTTTCAGGGTGTTACAGATGCTCACCAAGCGGCACGGCACCGGACGGAGGCGAGATAGCGGTGGTGCTCCAACGGCGGCCGATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 4.90% 18.39% 9.27% A: 0.06%
All Indica  2759 52.70% 5.80% 26.57% 14.82% A: 0.07%
All Japonica  1512 99.70% 0.00% 0.13% 0.13% NA
Aus  269 27.90% 25.70% 40.89% 5.58% NA
Indica I  595 21.80% 13.10% 52.77% 12.27% NA
Indica II  465 62.40% 4.90% 23.23% 9.46% NA
Indica III  913 65.90% 1.80% 13.91% 18.29% A: 0.11%
Indica Intermediate  786 55.00% 5.60% 23.41% 15.90% A: 0.13%
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 76.00% 2.10% 11.46% 10.42% NA
Intermediate  90 82.20% 0.00% 14.44% 2.22% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406880594 C -> DEL N N silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0406880594 C -> A LOC_Os04g12450.1 upstream_gene_variant ; 435.0bp to feature; MODIFIER silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0406880594 C -> A LOC_Os04g12440.1 downstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0406880594 C -> A LOC_Os04g12450-LOC_Os04g12460 intergenic_region ; MODIFIER silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0406880594 C -> T LOC_Os04g12450.1 upstream_gene_variant ; 435.0bp to feature; MODIFIER silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0406880594 C -> T LOC_Os04g12440.1 downstream_gene_variant ; 2460.0bp to feature; MODIFIER silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N
vg0406880594 C -> T LOC_Os04g12450-LOC_Os04g12460 intergenic_region ; MODIFIER silent_mutation Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406880594 NA 3.31E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 NA 1.51E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 NA 1.02E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 NA 7.51E-09 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 NA 1.54E-08 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 NA 1.04E-06 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 NA 1.55E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594 2.11E-06 2.11E-06 mr1983_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251