Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406880594:

Variant ID: vg0406880594 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6880594
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATCGGCCGCCGTTGGAGCACCACCGCTATCTCGCCTCCGTCCGGTGCCGTGCCGCTTGGTGAGCATCTGTAACACCCTGAAAATTCGACCAATAAAAA[C/T,A]
AAAACTCTAAAAATACGGACCTTCGAAAACTTTTTAAATTAATTGCATCATGCCAATTTTATTCGCCTATTTTATTTGGATTTGATTTCGAAGTTCATTA

Reverse complement sequence

TAATGAACTTCGAAATCAAATCCAAATAAAATAGGCGAATAAAATTGGCATGATGCAATTAATTTAAAAAGTTTTCGAAGGTCCGTATTTTTAGAGTTTT[G/A,T]
TTTTTATTGGTCGAATTTTCAGGGTGTTACAGATGCTCACCAAGCGGCACGGCACCGGACGGAGGCGAGATAGCGGTGGTGCTCCAACGGCGGCCGATGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	4.90%	18.39%	9.27%	A: 0.06%
All Indica	2759	52.70%	5.80%	26.57%	14.82%	A: 0.07%
All Japonica	1512	99.70%	0.00%	0.13%	0.13%	NA
Aus	269	27.90%	25.70%	40.89%	5.58%	NA
Indica I	595	21.80%	13.10%	52.77%	12.27%	NA
Indica II	465	62.40%	4.90%	23.23%	9.46%	NA
Indica III	913	65.90%	1.80%	13.91%	18.29%	A: 0.11%
Indica Intermediate	786	55.00%	5.60%	23.41%	15.90%	A: 0.13%
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	76.00%	2.10%	11.46%	10.42%	NA
Intermediate	90	82.20%	0.00%	14.44%	2.22%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406880594	C -> DEL	N	N	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0406880594	C -> A	LOC_Os04g12450.1	upstream_gene_variant ; 435.0bp to feature; MODIFIER	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0406880594	C -> A	LOC_Os04g12440.1	downstream_gene_variant ; 2460.0bp to feature; MODIFIER	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0406880594	C -> A	LOC_Os04g12450-LOC_Os04g12460	intergenic_region ; MODIFIER	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0406880594	C -> T	LOC_Os04g12450.1	upstream_gene_variant ; 435.0bp to feature; MODIFIER	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0406880594	C -> T	LOC_Os04g12440.1	downstream_gene_variant ; 2460.0bp to feature; MODIFIER	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N
vg0406880594	C -> T	LOC_Os04g12450-LOC_Os04g12460	intergenic_region ; MODIFIER	silent_mutation	Average:62.943; most accessible tissue: Minghui63 flag leaf, score: 78.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406880594	NA	3.31E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	NA	1.51E-08	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	NA	1.02E-07	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	NA	7.51E-09	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	NA	1.54E-08	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	NA	1.04E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	NA	1.55E-07	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406880594	2.11E-06	2.11E-06	mr1983_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251