Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406877935:

Variant ID: vg0406877935 (JBrowse)	Variation Type: INDEL
Chromosome: chr04	Position: 6877935
Reference Allele: A	Alternative Allele: G,ATG
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTTTATTTATCCCTTTGTAACTTTGTACATATTTTTTGATCTATAAAATTTAAAACTGCTGGGCATAGTCCTGGCAGTACTTCCAGTCAAAAAAAAAT[A/G,ATG]
TCATTGTGGTTATAGACCCATGCACTTTGCAAGTTTGCATGTCATCTAAATATAAATAAAATACTTAAAAATTTTGACAACGTGTTGTGTTTTTATAGGT

Reverse complement sequence

ACCTATAAAAACACAACACGTTGTCAAAATTTTTAAGTATTTTATTTATATTTAGATGACATGCAAACTTGCAAAGTGCATGGGTCTATAACCACAATGA[T/C,CAT]
ATTTTTTTTTGACTGGAAGTACTGCCAGGACTATGCCCAGCAGTTTTAAATTTTATAGATCAAAAAATATGTACAAAGTTACAAAGGGATAAATAAAAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.90%	14.90%	0.25%	51.82%	ATG: 0.17%
All Indica	2759	2.20%	22.50%	0.29%	74.66%	ATG: 0.29%
All Japonica	1512	94.60%	4.30%	0.20%	0.86%	NA
Aus	269	0.00%	2.20%	0.00%	97.77%	NA
Indica I	595	2.00%	6.40%	0.00%	91.60%	NA
Indica II	465	3.40%	16.60%	0.43%	78.92%	ATG: 0.65%
Indica III	913	1.10%	34.70%	0.33%	63.53%	ATG: 0.33%
Indica Intermediate	786	2.90%	24.20%	0.38%	72.26%	ATG: 0.25%
Temperate Japonica	767	96.00%	3.40%	0.39%	0.26%	NA
Tropical Japonica	504	94.80%	4.40%	0.00%	0.79%	NA
Japonica Intermediate	241	90.00%	7.10%	0.00%	2.90%	NA
VI/Aromatic	96	18.80%	0.00%	1.04%	80.21%	NA
Intermediate	90	50.00%	10.00%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406877935	A -> ATG	LOC_Os04g12450.1	downstream_gene_variant ; 1927.0bp to feature; MODIFIER	silent_mutation	Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0406877935	A -> ATG	LOC_Os04g12440.1	intron_variant ; MODIFIER	silent_mutation	Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0406877935	A -> DEL	N	N	silent_mutation	Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0406877935	A -> G	LOC_Os04g12450.1	downstream_gene_variant ; 1928.0bp to feature; MODIFIER	silent_mutation	Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0406877935	A -> G	LOC_Os04g12440.1	intron_variant ; MODIFIER	silent_mutation	Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406877935	6.54E-06	6.54E-06	mr1054	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	2.26E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	5.92E-07	5.92E-07	mr1379	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	4.38E-07	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	9.53E-06	mr1432	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	9.86E-06	mr1433	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	9.90E-06	1.69E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	1.11E-06	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	2.74E-08	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	6.17E-06	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	1.50E-06	mr1634	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	8.74E-06	8.73E-06	mr1661	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	1.26E-06	1.26E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	2.03E-06	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	1.80E-11	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	2.55E-07	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	9.53E-07	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	3.97E-07	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	1.24E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	2.05E-06	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	2.21E-09	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	6.80E-07	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	3.61E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	1.39E-09	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935	NA	5.29E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251