\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406877935:

Variant ID: vg0406877935 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 6877935
Reference Allele: AAlternative Allele: G,ATG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTTATTTATCCCTTTGTAACTTTGTACATATTTTTTGATCTATAAAATTTAAAACTGCTGGGCATAGTCCTGGCAGTACTTCCAGTCAAAAAAAAAT[A/G,ATG]
TCATTGTGGTTATAGACCCATGCACTTTGCAAGTTTGCATGTCATCTAAATATAAATAAAATACTTAAAAATTTTGACAACGTGTTGTGTTTTTATAGGT

Reverse complement sequence

ACCTATAAAAACACAACACGTTGTCAAAATTTTTAAGTATTTTATTTATATTTAGATGACATGCAAACTTGCAAAGTGCATGGGTCTATAACCACAATGA[T/C,CAT]
ATTTTTTTTTGACTGGAAGTACTGCCAGGACTATGCCCAGCAGTTTTAAATTTTATAGATCAAAAAATATGTACAAAGTTACAAAGGGATAAATAAAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.90% 14.90% 0.25% 51.82% ATG: 0.17%
All Indica  2759 2.20% 22.50% 0.29% 74.66% ATG: 0.29%
All Japonica  1512 94.60% 4.30% 0.20% 0.86% NA
Aus  269 0.00% 2.20% 0.00% 97.77% NA
Indica I  595 2.00% 6.40% 0.00% 91.60% NA
Indica II  465 3.40% 16.60% 0.43% 78.92% ATG: 0.65%
Indica III  913 1.10% 34.70% 0.33% 63.53% ATG: 0.33%
Indica Intermediate  786 2.90% 24.20% 0.38% 72.26% ATG: 0.25%
Temperate Japonica  767 96.00% 3.40% 0.39% 0.26% NA
Tropical Japonica  504 94.80% 4.40% 0.00% 0.79% NA
Japonica Intermediate  241 90.00% 7.10% 0.00% 2.90% NA
VI/Aromatic  96 18.80% 0.00% 1.04% 80.21% NA
Intermediate  90 50.00% 10.00% 0.00% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406877935 A -> ATG LOC_Os04g12450.1 downstream_gene_variant ; 1927.0bp to feature; MODIFIER silent_mutation Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0406877935 A -> ATG LOC_Os04g12440.1 intron_variant ; MODIFIER silent_mutation Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0406877935 A -> DEL N N silent_mutation Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0406877935 A -> G LOC_Os04g12450.1 downstream_gene_variant ; 1928.0bp to feature; MODIFIER silent_mutation Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0406877935 A -> G LOC_Os04g12440.1 intron_variant ; MODIFIER silent_mutation Average:19.697; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406877935 6.54E-06 6.54E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 2.26E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 5.92E-07 5.92E-07 mr1379 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 4.38E-07 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 9.53E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 9.86E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 9.90E-06 1.69E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 1.11E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 2.74E-08 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 6.17E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 1.50E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 8.74E-06 8.73E-06 mr1661 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 1.26E-06 1.26E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 2.03E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 1.80E-11 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 2.55E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 9.53E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 3.97E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 1.24E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 2.05E-06 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 2.21E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 6.80E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 3.61E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 1.39E-09 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877935 NA 5.29E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251