Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406877690:

Variant ID: vg0406877690 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6877690
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGATGATTGTTTTGGCAAGAATCAGGTTTGCACAAAGGGGTTTCCTTGAGGTTTTCTTTCTGGCAACATGGCATATTTGGAAGCAAAGAAATGGGCTA[A/T]
TTTTTCAGAATATTCAGCCTTCATTCCAATCATGGAAGTCTTTGCTTATGAAAGAAGTTCTTCTGCATATGTACAGAATGAAAGATCCTCTCAAGCAATC

Reverse complement sequence

GATTGCTTGAGAGGATCTTTCATTCTGTACATATGCAGAAGAACTTCTTTCATAAGCAAAGACTTCCATGATTGGAATGAAGGCTGAATATTCTGAAAAA[T/A]
TAGCCCATTTCTTTGCTTCCAAATATGCCATGTTGCCAGAAAGAAAACCTCAAGGAAACCCCTTTGTGCAAACCTGATTCTTGCCAAAACAATCATCTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.70%	2.80%	17.58%	30.89%	NA
All Indica	2759	26.00%	4.20%	25.99%	43.78%	NA
All Japonica	1512	99.10%	0.00%	0.26%	0.60%	NA
Aus	269	4.10%	5.20%	31.60%	59.11%	NA
Indica I	595	9.20%	5.40%	24.03%	61.34%	NA
Indica II	465	21.30%	6.00%	37.42%	35.27%	NA
Indica III	913	37.30%	2.60%	20.59%	39.43%	NA
Indica Intermediate	786	28.20%	4.20%	26.97%	40.59%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	97.10%	0.00%	0.83%	2.07%	NA
VI/Aromatic	96	22.90%	1.00%	12.50%	63.54%	NA
Intermediate	90	58.90%	1.10%	14.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406877690	A -> DEL	N	N	silent_mutation	Average:20.104; most accessible tissue: Callus, score: 34.93	N	N	N	N
vg0406877690	A -> T	LOC_Os04g12430.1	downstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:20.104; most accessible tissue: Callus, score: 34.93	N	N	N	N
vg0406877690	A -> T	LOC_Os04g12450.1	downstream_gene_variant ; 2173.0bp to feature; MODIFIER	silent_mutation	Average:20.104; most accessible tissue: Callus, score: 34.93	N	N	N	N
vg0406877690	A -> T	LOC_Os04g12440.1	intron_variant ; MODIFIER	silent_mutation	Average:20.104; most accessible tissue: Callus, score: 34.93	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406877690	3.24E-06	3.24E-06	mr1054	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	NA	4.66E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	NA	1.06E-08	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	NA	8.29E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	8.49E-06	8.48E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	NA	1.51E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	NA	4.04E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	NA	2.12E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	9.03E-06	NA	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	6.02E-07	6.02E-07	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690	1.56E-06	8.64E-11	mr1846	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251