\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406877690:

Variant ID: vg0406877690 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6877690
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TCAGATGATTGTTTTGGCAAGAATCAGGTTTGCACAAAGGGGTTTCCTTGAGGTTTTCTTTCTGGCAACATGGCATATTTGGAAGCAAAGAAATGGGCTA[A/T]
TTTTTCAGAATATTCAGCCTTCATTCCAATCATGGAAGTCTTTGCTTATGAAAGAAGTTCTTCTGCATATGTACAGAATGAAAGATCCTCTCAAGCAATC

Reverse complement sequence

GATTGCTTGAGAGGATCTTTCATTCTGTACATATGCAGAAGAACTTCTTTCATAAGCAAAGACTTCCATGATTGGAATGAAGGCTGAATATTCTGAAAAA[T/A]
TAGCCCATTTCTTTGCTTCCAAATATGCCATGTTGCCAGAAAGAAAACCTCAAGGAAACCCCTTTGTGCAAACCTGATTCTTGCCAAAACAATCATCTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 2.80% 17.58% 30.89% NA
All Indica  2759 26.00% 4.20% 25.99% 43.78% NA
All Japonica  1512 99.10% 0.00% 0.26% 0.60% NA
Aus  269 4.10% 5.20% 31.60% 59.11% NA
Indica I  595 9.20% 5.40% 24.03% 61.34% NA
Indica II  465 21.30% 6.00% 37.42% 35.27% NA
Indica III  913 37.30% 2.60% 20.59% 39.43% NA
Indica Intermediate  786 28.20% 4.20% 26.97% 40.59% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 99.20% 0.00% 0.20% 0.60% NA
Japonica Intermediate  241 97.10% 0.00% 0.83% 2.07% NA
VI/Aromatic  96 22.90% 1.00% 12.50% 63.54% NA
Intermediate  90 58.90% 1.10% 14.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406877690 A -> DEL N N silent_mutation Average:20.104; most accessible tissue: Callus, score: 34.93 N N N N
vg0406877690 A -> T LOC_Os04g12430.1 downstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:20.104; most accessible tissue: Callus, score: 34.93 N N N N
vg0406877690 A -> T LOC_Os04g12450.1 downstream_gene_variant ; 2173.0bp to feature; MODIFIER silent_mutation Average:20.104; most accessible tissue: Callus, score: 34.93 N N N N
vg0406877690 A -> T LOC_Os04g12440.1 intron_variant ; MODIFIER silent_mutation Average:20.104; most accessible tissue: Callus, score: 34.93 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406877690 3.24E-06 3.24E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 NA 4.66E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 NA 1.06E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 NA 8.29E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 8.49E-06 8.48E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 NA 1.51E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 NA 4.04E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 NA 2.12E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 9.03E-06 NA mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 6.02E-07 6.02E-07 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877690 1.56E-06 8.64E-11 mr1846 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251