\
| Variant ID: vg0406877690 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6877690 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 94. )
TCAGATGATTGTTTTGGCAAGAATCAGGTTTGCACAAAGGGGTTTCCTTGAGGTTTTCTTTCTGGCAACATGGCATATTTGGAAGCAAAGAAATGGGCTA[A/T]
TTTTTCAGAATATTCAGCCTTCATTCCAATCATGGAAGTCTTTGCTTATGAAAGAAGTTCTTCTGCATATGTACAGAATGAAAGATCCTCTCAAGCAATC
GATTGCTTGAGAGGATCTTTCATTCTGTACATATGCAGAAGAACTTCTTTCATAAGCAAAGACTTCCATGATTGGAATGAAGGCTGAATATTCTGAAAAA[T/A]
TAGCCCATTTCTTTGCTTCCAAATATGCCATGTTGCCAGAAAGAAAACCTCAAGGAAACCCCTTTGTGCAAACCTGATTCTTGCCAAAACAATCATCTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 2.80% | 17.58% | 30.89% | NA |
| All Indica | 2759 | 26.00% | 4.20% | 25.99% | 43.78% | NA |
| All Japonica | 1512 | 99.10% | 0.00% | 0.26% | 0.60% | NA |
| Aus | 269 | 4.10% | 5.20% | 31.60% | 59.11% | NA |
| Indica I | 595 | 9.20% | 5.40% | 24.03% | 61.34% | NA |
| Indica II | 465 | 21.30% | 6.00% | 37.42% | 35.27% | NA |
| Indica III | 913 | 37.30% | 2.60% | 20.59% | 39.43% | NA |
| Indica Intermediate | 786 | 28.20% | 4.20% | 26.97% | 40.59% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 22.90% | 1.00% | 12.50% | 63.54% | NA |
| Intermediate | 90 | 58.90% | 1.10% | 14.44% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406877690 | A -> DEL | N | N | silent_mutation | Average:20.104; most accessible tissue: Callus, score: 34.93 | N | N | N | N |
| vg0406877690 | A -> T | LOC_Os04g12430.1 | downstream_gene_variant ; 4827.0bp to feature; MODIFIER | silent_mutation | Average:20.104; most accessible tissue: Callus, score: 34.93 | N | N | N | N |
| vg0406877690 | A -> T | LOC_Os04g12450.1 | downstream_gene_variant ; 2173.0bp to feature; MODIFIER | silent_mutation | Average:20.104; most accessible tissue: Callus, score: 34.93 | N | N | N | N |
| vg0406877690 | A -> T | LOC_Os04g12440.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.104; most accessible tissue: Callus, score: 34.93 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406877690 | 3.24E-06 | 3.24E-06 | mr1054 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | NA | 4.66E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | NA | 1.06E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | NA | 8.29E-06 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | 8.49E-06 | 8.48E-06 | mr1287 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | NA | 1.51E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | NA | 4.04E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | NA | 2.12E-11 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | 9.03E-06 | NA | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | 6.02E-07 | 6.02E-07 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877690 | 1.56E-06 | 8.64E-11 | mr1846 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |