\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406877319:

Variant ID: vg0406877319 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6877319
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAAGAGGAATTGAATCATCTGCAGCTTCAGCTAGGAAGAAGTGATGTTTGGAGTTTTATTTGGGGAACAGGTATATACACAGCCAAGAGATTTTACAA[G/T]
CTCAATTACTCTTCTTTGCAACCTCCTAGGCCCATGATTTGGCTGTGGAAACCAAATGTGTCATGAAGATTGTTCGCATGGCTTCTGTTCTGTGATAGAC

Reverse complement sequence

GTCTATCACAGAACAGAAGCCATGCGAACAATCTTCATGACACATTTGGTTTCCACAGCCAAATCATGGGCCTAGGAGGTTGCAAAGAAGAGTAATTGAG[C/A]
TTGTAAAATCTCTTGGCTGTGTATATACCTGTTCCCCAAATAAAACTCCAAACATCACTTCTTCCTAGCTGAAGCTGCAGATGATTCAATTCCTCTTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 37.70% 0.89% 12.99% NA
All Indica  2759 25.60% 56.20% 1.30% 16.89% NA
All Japonica  1512 99.20% 0.30% 0.00% 0.53% NA
Aus  269 3.00% 69.10% 0.37% 27.51% NA
Indica I  595 8.70% 74.60% 0.34% 16.30% NA
Indica II  465 21.50% 58.90% 4.30% 15.27% NA
Indica III  913 36.80% 44.10% 0.55% 18.51% NA
Indica Intermediate  786 27.70% 54.70% 1.15% 16.41% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 97.50% 0.40% 0.00% 2.07% NA
VI/Aromatic  96 24.00% 17.70% 2.08% 56.25% NA
Intermediate  90 57.80% 25.60% 3.33% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406877319 G -> DEL N N silent_mutation Average:29.519; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0406877319 G -> T LOC_Os04g12430.1 downstream_gene_variant ; 4456.0bp to feature; MODIFIER silent_mutation Average:29.519; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0406877319 G -> T LOC_Os04g12450.1 downstream_gene_variant ; 2544.0bp to feature; MODIFIER silent_mutation Average:29.519; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg0406877319 G -> T LOC_Os04g12440.1 intron_variant ; MODIFIER silent_mutation Average:29.519; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406877319 1.24E-06 5.62E-08 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 9.14E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 5.11E-08 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 1.99E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 2.36E-06 2.54E-07 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 1.20E-06 9.23E-08 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 5.82E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 4.37E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 4.09E-06 7.75E-08 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 5.80E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 5.36E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 3.36E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 5.50E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 6.14E-08 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 1.82E-06 5.62E-08 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 2.83E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 1.10E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 3.12E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 6.17E-06 6.17E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 3.08E-06 3.08E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 6.13E-07 6.13E-07 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 4.59E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 5.44E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 3.08E-08 NA mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 9.59E-07 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 6.86E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 2.29E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 4.94E-08 1.02E-08 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 NA 3.10E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 6.26E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 7.00E-06 1.02E-08 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406877319 1.90E-06 NA mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251