\
| Variant ID: vg0406877172 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6877172 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, G: 0.06, others allele: 0.00, population size: 94. )
ATGATGATTTTAAGTGCACAAGCTACCCTAATCTGTTCAGTGTGACTTTGTATAAGAATGATTCAGTTAGGACCATGTGCCTACGGCCAATGGAGGACTC[T/G]
TTTGTTCTTCCCCTCTCAGATGATGCATGTGGAGAATTTTTGCAACTGCAAGAGGAATTGAATCATCTGCAGCTTCAGCTAGGAAGAAGTGATGTTTGGA
TCCAAACATCACTTCTTCCTAGCTGAAGCTGCAGATGATTCAATTCCTCTTGCAGTTGCAAAAATTCTCCACATGCATCATCTGAGAGGGGAAGAACAAA[A/C]
GAGTCCTCCATTGGCCGTAGGCACATGGTCCTAACTGAATCATTCTTATACAAAGTCACACTGAACAGATTAGGGTAGCTTGTGCACTTAAAATCATCAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 37.00% | 4.51% | 8.87% | NA |
| All Indica | 2759 | 27.30% | 55.10% | 6.09% | 11.60% | NA |
| All Japonica | 1512 | 99.30% | 0.30% | 0.33% | 0.13% | NA |
| Aus | 269 | 3.00% | 69.50% | 0.37% | 27.14% | NA |
| Indica I | 595 | 10.90% | 70.30% | 8.07% | 10.76% | NA |
| Indica II | 465 | 23.00% | 60.60% | 9.25% | 7.10% | NA |
| Indica III | 913 | 38.00% | 42.90% | 4.38% | 14.68% | NA |
| Indica Intermediate | 786 | 29.60% | 54.30% | 4.71% | 11.32% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.40% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 17.70% | 34.38% | 16.67% | NA |
| Intermediate | 90 | 58.90% | 25.60% | 6.67% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406877172 | T -> DEL | LOC_Os04g12440.1 | N | frameshift_variant | Average:33.327; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| vg0406877172 | T -> G | LOC_Os04g12440.1 | synonymous_variant ; p.Ser651Ser; LOW | synonymous_codon | Average:33.327; most accessible tissue: Minghui63 flower, score: 60.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406877172 | NA | 6.94E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 2.46E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 7.59E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | 6.40E-06 | 6.40E-06 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 3.74E-06 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 3.22E-06 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 3.76E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 1.38E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | 3.05E-06 | NA | mr1882_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406877172 | NA | 6.00E-07 | mr1882_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |