Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406873204:

Variant ID: vg0406873204 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6873204
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

TTGCCCCAAAACGTTTTGATTCGTTTGCTTTTGCACCCTCTAGTGGTGCCTCAGGGGCATTTTGGTTGTTTAGTCTTCAAGGGTTTTTGTCGGAGCTGTG[G/C]
CGGAAATTAATCTGTTCTCTGTGTTTGTTGATTTCAATTTGAGGCATACTGCTCAAACCTGGTCCTTGACTTGTGTTTATGGCCCTTGTGGTGGCCCAGA

Reverse complement sequence

TCTGGGCCACCACAAGGGCCATAAACACAAGTCAAGGACCAGGTTTGAGCAGTATGCCTCAAATTGAAATCAACAAACACAGAGAACAGATTAATTTCCG[C/G]
CACAGCTCCGACAAAAACCCTTGAAGACTAAACAACCAAAATGCCCCTGAGGCACCACTAGAGGGTGCAAAAGCAAACGAATCAAAACGTTTTGGGGCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.00%	5.20%	0.49%	51.35%	NA
All Indica	2759	16.70%	8.60%	0.72%	74.01%	NA
All Japonica	1512	99.00%	0.10%	0.00%	0.86%	NA
Aus	269	2.20%	0.40%	0.37%	97.03%	NA
Indica I	595	2.20%	5.70%	0.17%	91.93%	NA
Indica II	465	11.40%	10.10%	2.15%	76.34%	NA
Indica III	913	32.70%	3.50%	0.22%	63.53%	NA
Indica Intermediate	786	12.20%	15.60%	0.89%	71.25%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	99.00%	0.20%	0.00%	0.79%	NA
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	19.80%	1.00%	1.04%	78.12%	NA
Intermediate	90	52.20%	6.70%	1.11%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406873204	G -> C	LOC_Os04g12440.1	upstream_gene_variant ; 646.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0406873204	G -> C	LOC_Os04g12430.1	downstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0406873204	G -> C	LOC_Os04g12430-LOC_Os04g12440	intergenic_region ; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N
vg0406873204	G -> DEL	N	N	silent_mutation	Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406873204	NA	3.41E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	9.32E-08	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	1.73E-06	mr1210	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	9.85E-10	mr1305	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	5.22E-07	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	3.27E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	4.84E-09	mr1586	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	8.47E-07	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	2.56E-06	1.93E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	2.40E-06	2.40E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204	NA	4.85E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251