\
| Variant ID: vg0406873204 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6873204 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 85. )
TTGCCCCAAAACGTTTTGATTCGTTTGCTTTTGCACCCTCTAGTGGTGCCTCAGGGGCATTTTGGTTGTTTAGTCTTCAAGGGTTTTTGTCGGAGCTGTG[G/C]
CGGAAATTAATCTGTTCTCTGTGTTTGTTGATTTCAATTTGAGGCATACTGCTCAAACCTGGTCCTTGACTTGTGTTTATGGCCCTTGTGGTGGCCCAGA
TCTGGGCCACCACAAGGGCCATAAACACAAGTCAAGGACCAGGTTTGAGCAGTATGCCTCAAATTGAAATCAACAAACACAGAGAACAGATTAATTTCCG[C/G]
CACAGCTCCGACAAAAACCCTTGAAGACTAAACAACCAAAATGCCCCTGAGGCACCACTAGAGGGTGCAAAAGCAAACGAATCAAAACGTTTTGGGGCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.00% | 5.20% | 0.49% | 51.35% | NA |
| All Indica | 2759 | 16.70% | 8.60% | 0.72% | 74.01% | NA |
| All Japonica | 1512 | 99.00% | 0.10% | 0.00% | 0.86% | NA |
| Aus | 269 | 2.20% | 0.40% | 0.37% | 97.03% | NA |
| Indica I | 595 | 2.20% | 5.70% | 0.17% | 91.93% | NA |
| Indica II | 465 | 11.40% | 10.10% | 2.15% | 76.34% | NA |
| Indica III | 913 | 32.70% | 3.50% | 0.22% | 63.53% | NA |
| Indica Intermediate | 786 | 12.20% | 15.60% | 0.89% | 71.25% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 19.80% | 1.00% | 1.04% | 78.12% | NA |
| Intermediate | 90 | 52.20% | 6.70% | 1.11% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406873204 | G -> C | LOC_Os04g12440.1 | upstream_gene_variant ; 646.0bp to feature; MODIFIER | silent_mutation | Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0406873204 | G -> C | LOC_Os04g12430.1 | downstream_gene_variant ; 341.0bp to feature; MODIFIER | silent_mutation | Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0406873204 | G -> C | LOC_Os04g12430-LOC_Os04g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| vg0406873204 | G -> DEL | N | N | silent_mutation | Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406873204 | NA | 3.41E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 9.32E-08 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 1.73E-06 | mr1210 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 9.85E-10 | mr1305 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 5.22E-07 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 3.27E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 4.84E-09 | mr1586 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 8.47E-07 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | 2.56E-06 | 1.93E-06 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | 2.40E-06 | 2.40E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406873204 | NA | 4.85E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |