\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406873204:

Variant ID: vg0406873204 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6873204
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCCCCAAAACGTTTTGATTCGTTTGCTTTTGCACCCTCTAGTGGTGCCTCAGGGGCATTTTGGTTGTTTAGTCTTCAAGGGTTTTTGTCGGAGCTGTG[G/C]
CGGAAATTAATCTGTTCTCTGTGTTTGTTGATTTCAATTTGAGGCATACTGCTCAAACCTGGTCCTTGACTTGTGTTTATGGCCCTTGTGGTGGCCCAGA

Reverse complement sequence

TCTGGGCCACCACAAGGGCCATAAACACAAGTCAAGGACCAGGTTTGAGCAGTATGCCTCAAATTGAAATCAACAAACACAGAGAACAGATTAATTTCCG[C/G]
CACAGCTCCGACAAAAACCCTTGAAGACTAAACAACCAAAATGCCCCTGAGGCACCACTAGAGGGTGCAAAAGCAAACGAATCAAAACGTTTTGGGGCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 5.20% 0.49% 51.35% NA
All Indica  2759 16.70% 8.60% 0.72% 74.01% NA
All Japonica  1512 99.00% 0.10% 0.00% 0.86% NA
Aus  269 2.20% 0.40% 0.37% 97.03% NA
Indica I  595 2.20% 5.70% 0.17% 91.93% NA
Indica II  465 11.40% 10.10% 2.15% 76.34% NA
Indica III  913 32.70% 3.50% 0.22% 63.53% NA
Indica Intermediate  786 12.20% 15.60% 0.89% 71.25% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 99.00% 0.20% 0.00% 0.79% NA
Japonica Intermediate  241 97.10% 0.00% 0.00% 2.90% NA
VI/Aromatic  96 19.80% 1.00% 1.04% 78.12% NA
Intermediate  90 52.20% 6.70% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406873204 G -> C LOC_Os04g12440.1 upstream_gene_variant ; 646.0bp to feature; MODIFIER silent_mutation Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0406873204 G -> C LOC_Os04g12430.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0406873204 G -> C LOC_Os04g12430-LOC_Os04g12440 intergenic_region ; MODIFIER silent_mutation Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0406873204 G -> DEL N N silent_mutation Average:19.333; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406873204 NA 3.41E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 9.32E-08 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 1.73E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 9.85E-10 mr1305 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 5.22E-07 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 3.27E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 4.84E-09 mr1586 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 8.47E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 2.56E-06 1.93E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 2.40E-06 2.40E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406873204 NA 4.85E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251