\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406871429:

Variant ID: vg0406871429 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6871429
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGATTACCACCTTGACTTTATTGATTGGGACCATCTAAACCTTGCTACGGCTACATTTGGCCAACTTTCTTTTTGGCTTGAAAGGGATCAGATCAAGG[G/T]
GAGAGTTCTGATAAGGGCTAAGTTAAAGGATAATGATTTTGTGCCTCCAAAAATTGTTTTTGCATGATCCGGTGGGTATGGGCGGAGGAGGAGAATCATG

Reverse complement sequence

CATGATTCTCCTCCTCCGCCCATACCCACCGGATCATGCAAAAACAATTTTTGGAGGCACAAAATCATTATCCTTTAACTTAGCCCTTATCAGAACTCTC[C/A]
CCTTGATCTGATCCCTTTCAAGCCAAAAAGAAAGTTGGCCAAATGTAGCCGTAGCAAGGTTTAGATGGTCCCAATCAATAAAGTCAAGGTGGTAATCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 29.20% 9.25% 11.45% NA
All Indica  2759 28.20% 43.20% 13.05% 15.51% NA
All Japonica  1512 99.20% 0.20% 0.20% 0.40% NA
Aus  269 3.70% 57.20% 11.15% 27.88% NA
Indica I  595 11.60% 51.40% 21.51% 15.46% NA
Indica II  465 24.10% 46.00% 17.20% 12.69% NA
Indica III  913 38.30% 37.00% 7.23% 17.42% NA
Indica Intermediate  786 31.40% 42.60% 10.94% 15.01% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.20% 0.20% 0.40% NA
Japonica Intermediate  241 97.50% 0.40% 0.83% 1.24% NA
VI/Aromatic  96 27.10% 9.40% 36.46% 27.08% NA
Intermediate  90 62.20% 21.10% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406871429 G -> DEL N N silent_mutation Average:34.21; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0406871429 G -> T LOC_Os04g12430.1 5_prime_UTR_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:34.21; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0406871429 G -> T LOC_Os04g12440.1 upstream_gene_variant ; 2421.0bp to feature; MODIFIER silent_mutation Average:34.21; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406871429 NA 4.31E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 4.42E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 8.16E-06 3.31E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 4.31E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 3.07E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 8.08E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 1.56E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 7.39E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 5.54E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 4.79E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 2.13E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 5.96E-06 5.96E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 4.69E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 1.24E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 2.09E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 2.69E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 4.81E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 1.31E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 7.71E-06 NA mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 8.31E-07 8.31E-07 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 6.19E-06 6.19E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 4.41E-07 NA mr1777 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 1.04E-08 1.04E-08 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 4.42E-06 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429 NA 1.40E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251