Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406871429:

Variant ID: vg0406871429 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6871429
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TTGGATTACCACCTTGACTTTATTGATTGGGACCATCTAAACCTTGCTACGGCTACATTTGGCCAACTTTCTTTTTGGCTTGAAAGGGATCAGATCAAGG[G/T]
GAGAGTTCTGATAAGGGCTAAGTTAAAGGATAATGATTTTGTGCCTCCAAAAATTGTTTTTGCATGATCCGGTGGGTATGGGCGGAGGAGGAGAATCATG

Reverse complement sequence

CATGATTCTCCTCCTCCGCCCATACCCACCGGATCATGCAAAAACAATTTTTGGAGGCACAAAATCATTATCCTTTAACTTAGCCCTTATCAGAACTCTC[C/A]
CCTTGATCTGATCCCTTTCAAGCCAAAAAGAAAGTTGGCCAAATGTAGCCGTAGCAAGGTTTAGATGGTCCCAATCAATAAAGTCAAGGTGGTAATCCAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	29.20%	9.25%	11.45%	NA
All Indica	2759	28.20%	43.20%	13.05%	15.51%	NA
All Japonica	1512	99.20%	0.20%	0.20%	0.40%	NA
Aus	269	3.70%	57.20%	11.15%	27.88%	NA
Indica I	595	11.60%	51.40%	21.51%	15.46%	NA
Indica II	465	24.10%	46.00%	17.20%	12.69%	NA
Indica III	913	38.30%	37.00%	7.23%	17.42%	NA
Indica Intermediate	786	31.40%	42.60%	10.94%	15.01%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.20%	0.20%	0.40%	NA
Japonica Intermediate	241	97.50%	0.40%	0.83%	1.24%	NA
VI/Aromatic	96	27.10%	9.40%	36.46%	27.08%	NA
Intermediate	90	62.20%	21.10%	10.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406871429	G -> DEL	N	N	silent_mutation	Average:34.21; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0406871429	G -> T	LOC_Os04g12430.1	5_prime_UTR_variant ; 339.0bp to feature; MODIFIER	silent_mutation	Average:34.21; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0406871429	G -> T	LOC_Os04g12440.1	upstream_gene_variant ; 2421.0bp to feature; MODIFIER	silent_mutation	Average:34.21; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406871429	NA	4.31E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	4.42E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	8.16E-06	3.31E-06	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	4.31E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	3.07E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	8.08E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	1.56E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	7.39E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	5.54E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	4.79E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	2.13E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	5.96E-06	5.96E-06	mr1512	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	4.69E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	1.24E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	2.09E-06	mr1618	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	2.69E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	4.81E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	1.31E-06	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	7.71E-06	NA	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	8.31E-07	8.31E-07	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	6.19E-06	6.19E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	4.41E-07	NA	mr1777	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	1.04E-08	1.04E-08	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	4.42E-06	mr1913	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406871429	NA	1.40E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251