\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406863365:

Variant ID: vg0406863365 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6863365
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGGCTCGTCGTGAGCCGTCTCCTTTATTCCGCATTTTGCAGAGTCTTTTTGGTCTTTGCTCCGCGGAGGCCAAAAAGAACTGCCGATTGCGGAATTCA[A/G]
CGAAGAAAACGGCTCGCGACGTCAAATTCCTCAAGGCAAGGTATTATGAGGATCATCACATCGATATCCCTCCTTCTCCTCCGGGTTTCGAGGCCGAGCC

Reverse complement sequence

GGCTCGGCCTCGAAACCCGGAGGAGAAGGAGGGATATCGATGTGATGATCCTCATAATACCTTGCCTTGAGGAATTTGACGTCGCGAGCCGTTTTCTTCG[T/C]
TGAATTCCGCAATCGGCAGTTCTTTTTGGCCTCCGCGGAGCAAAGACCAAAAAGACTCTGCAAAATGCGGAATAAAGGAGACGGCTCACGACGAGCCACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 44.00% 0.38% 11.68% NA
All Indica  2759 20.50% 63.00% 0.58% 15.88% NA
All Japonica  1512 95.30% 4.20% 0.07% 0.46% NA
Aus  269 0.70% 72.50% 0.00% 26.77% NA
Indica I  595 7.40% 75.60% 0.50% 16.47% NA
Indica II  465 20.40% 64.70% 1.29% 13.55% NA
Indica III  913 25.20% 57.90% 0.44% 16.43% NA
Indica Intermediate  786 25.10% 58.40% 0.38% 16.16% NA
Temperate Japonica  767 96.90% 3.00% 0.00% 0.13% NA
Tropical Japonica  504 95.40% 4.00% 0.20% 0.40% NA
Japonica Intermediate  241 90.00% 8.30% 0.00% 1.66% NA
VI/Aromatic  96 19.80% 52.10% 0.00% 28.12% NA
Intermediate  90 55.60% 34.40% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406863365 A -> DEL LOC_Os04g12420.1 N frameshift_variant Average:35.877; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0406863365 A -> G LOC_Os04g12420.1 missense_variant ; p.Thr856Ala; MODERATE nonsynonymous_codon ; T856A Average:35.877; most accessible tissue: Minghui63 young leaf, score: 62.741 unknown unknown TOLERATED 0.53

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406863365 NA 3.50E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 2.18E-06 2.18E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 8.13E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 2.48E-06 2.48E-06 mr1270 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 4.06E-06 4.06E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 9.64E-07 9.64E-07 mr1311 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 2.94E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 7.69E-06 7.69E-06 mr1417 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 6.48E-07 6.48E-07 mr1469 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 4.47E-06 4.47E-06 mr1485 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 4.02E-06 4.02E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 7.89E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 4.20E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 9.80E-07 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 8.42E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 5.03E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 1.30E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 2.81E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 1.25E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 2.57E-06 2.57E-06 mr1643 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 6.07E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 9.30E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 4.48E-20 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 4.65E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 4.72E-06 4.72E-06 mr1966 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 6.38E-06 6.38E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 1.25E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 4.08E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 6.29E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863365 NA 4.82E-18 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251