\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406863364:

Variant ID: vg0406863364 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6863364
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.86, G: 0.14, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTGGCTCGTCGTGAGCCGTCTCCTTTATTCCGCATTTTGCAGAGTCTTTTTGGTCTTTGCTCCGCGGAGGCCAAAAAGAACTGCCGATTGCGGAATTC[A/G]
ACGAAGAAAACGGCTCGCGACGTCAAATTCCTCAAGGCAAGGTATTATGAGGATCATCACATCGATATCCCTCCTTCTCCTCCGGGTTTCGAGGCCGAGC

Reverse complement sequence

GCTCGGCCTCGAAACCCGGAGGAGAAGGAGGGATATCGATGTGATGATCCTCATAATACCTTGCCTTGAGGAATTTGACGTCGCGAGCCGTTTTCTTCGT[T/C]
GAATTCCGCAATCGGCAGTTCTTTTTGGCCTCCGCGGAGCAAAGACCAAAAAGACTCTGCAAAATGCGGAATAAAGGAGACGGCTCACGACGAGCCACAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.70% 41.30% 0.38% 11.66% NA
All Indica  2759 22.90% 60.60% 0.62% 15.84% NA
All Japonica  1512 99.10% 0.50% 0.00% 0.46% NA
Aus  269 2.20% 71.00% 0.00% 26.77% NA
Indica I  595 7.40% 75.50% 0.50% 16.64% NA
Indica II  465 20.40% 64.50% 1.29% 13.76% NA
Indica III  913 31.70% 51.80% 0.22% 16.32% NA
Indica Intermediate  786 26.10% 57.30% 0.76% 15.90% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.00% 0.60% 0.00% 0.40% NA
Japonica Intermediate  241 97.10% 1.20% 0.00% 1.66% NA
VI/Aromatic  96 19.80% 52.10% 0.00% 28.12% NA
Intermediate  90 55.60% 34.40% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406863364 A -> DEL LOC_Os04g12420.1 N frameshift_variant Average:35.877; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0406863364 A -> G LOC_Os04g12420.1 synonymous_variant ; p.Ser855Ser; LOW synonymous_codon Average:35.877; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406863364 NA 6.66E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 1.70E-06 1.70E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 3.09E-06 NA mr1081 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 8.14E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 8.12E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 3.45E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 8.76E-06 8.76E-06 mr1270 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 4.08E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 4.35E-06 4.35E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 3.65E-06 3.65E-06 mr1293 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 7.42E-06 7.42E-06 mr1353 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 8.18E-06 1.06E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 7.95E-06 7.95E-06 mr1393 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 5.67E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 3.22E-06 3.22E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 1.66E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 1.01E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 1.58E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 3.51E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 3.43E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 1.76E-06 1.76E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 2.11E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 6.49E-06 6.48E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 6.49E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 1.67E-06 1.67E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 2.65E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 1.53E-06 1.53E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863364 NA 1.22E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251