\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406863298:

Variant ID: vg0406863298 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6863298
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAGCCGCTCGGGACATCCCCTCCTCTTCCACTCAGCCGCCTCCTGCTCCTGAGCGCCCTTCCTCTGTGGCTCGTCGTGAGCCGTCTCCTTTATTCCG[C/T]
ATTTTGCAGAGTCTTTTTGGTCTTTGCTCCGCGGAGGCCAAAAAGAACTGCCGATTGCGGAATTCAACGAAGAAAACGGCTCGCGACGTCAAATTCCTCA

Reverse complement sequence

TGAGGAATTTGACGTCGCGAGCCGTTTTCTTCGTTGAATTCCGCAATCGGCAGTTCTTTTTGGCCTCCGCGGAGCAAAGACCAAAAAGACTCTGCAAAAT[G/A]
CGGAATAAAGGAGACGGCTCACGACGAGCCACAGAGGAAGGGCGCTCAGGAGCAGGAGGCGGCTGAGTGGAAGAGGAGGGGATGTCCCGAGCGGCTGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.00% 38.00% 0.63% 11.30% NA
All Indica  2759 27.00% 56.70% 1.09% 15.26% NA
All Japonica  1512 99.30% 0.30% 0.00% 0.40% NA
Aus  269 2.60% 70.60% 0.00% 26.77% NA
Indica I  595 8.10% 75.80% 0.50% 15.63% NA
Indica II  465 26.90% 58.30% 1.51% 13.33% NA
Indica III  913 38.00% 44.90% 1.10% 15.99% NA
Indica Intermediate  786 28.50% 55.00% 1.27% 15.27% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 56.20% 15.60% 0.00% 28.12% NA
Intermediate  90 65.60% 25.60% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406863298 C -> DEL N N silent_mutation Average:36.452; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N
vg0406863298 C -> T LOC_Os04g12420.1 intron_variant ; MODIFIER silent_mutation Average:36.452; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406863298 NA 1.30E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 2.31E-06 1.14E-07 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 4.07E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 4.51E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 5.76E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 4.50E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 5.13E-06 8.43E-16 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 2.65E-06 2.10E-07 mr1626 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 3.49E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 9.69E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 1.26E-06 1.26E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 9.60E-06 9.60E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 1.05E-17 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 5.30E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 7.80E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 4.59E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406863298 NA 1.86E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251