Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406862446:

Variant ID: vg0406862446 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6862446
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGGGATCCAGCGGTGATTCGCCAAGTGTATGATTGGAGGCGGAAGACTGAGGTTGTTGCTCCCTGGTGGGATGAGGATCCGCGCCCTCTTCACCACTC[C/T]
GCCACGAATCCGCGGTTTTGGACTCTCTTTCAACAAGACTTTTATGAGTCAGTGATCAAGTCCAAAGCTCATCCCACCGTTCCCATGCAATGGATCAACT

Reverse complement sequence

AGTTGATCCATTGCATGGGAACGGTGGGATGAGCTTTGGACTTGATCACTGACTCATAAAAGTCTTGTTGAAAGAGAGTCCAAAACCGCGGATTCGTGGC[G/A]
GAGTGGTGAAGAGGGCGCGGATCCTCATCCCACCAGGGAGCAACAACCTCAGTCTTCCGCCTCCAATCATACACTTGGCGAATCACCGCTGGATCCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 42.10% 0.51% 11.43% NA
All Indica  2759 22.10% 61.60% 0.76% 15.51% NA
All Japonica  1512 95.60% 3.90% 0.07% 0.46% NA
Aus  269 1.50% 72.10% 0.37% 26.02% NA
Indica I  595 7.70% 75.50% 0.84% 15.97% NA
Indica II  465 21.50% 63.70% 1.08% 13.76% NA
Indica III  913 27.90% 55.40% 0.33% 16.32% NA
Indica Intermediate  786 26.70% 57.00% 1.02% 15.27% NA
Temperate Japonica  767 96.90% 3.00% 0.00% 0.13% NA
Tropical Japonica  504 95.80% 3.60% 0.20% 0.40% NA
Japonica Intermediate  241 90.90% 7.50% 0.00% 1.66% NA
VI/Aromatic  96 55.20% 16.70% 0.00% 28.12% NA
Intermediate  90 64.40% 25.60% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406862446 C -> DEL LOC_Os04g12420.1 N frameshift_variant Average:41.079; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N
vg0406862446 C -> T LOC_Os04g12420.1 synonymous_variant ; p.Ser622Ser; LOW synonymous_codon Average:41.079; most accessible tissue: Zhenshan97 young leaf, score: 72.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406862446 NA 1.75E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 1.64E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 2.24E-09 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 2.56E-07 7.79E-08 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 3.70E-08 NA mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 5.21E-07 1.15E-08 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 3.02E-08 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 4.16E-06 7.70E-07 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 2.82E-08 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 1.24E-07 6.30E-08 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 8.39E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 1.20E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 8.84E-08 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 1.98E-06 1.57E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 7.22E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 4.79E-06 4.79E-06 mr1468 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 2.62E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 1.98E-10 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 3.97E-06 9.33E-08 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 9.84E-09 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 9.61E-07 1.16E-07 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 6.97E-06 NA mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 3.41E-06 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 7.69E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 5.60E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 6.93E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 9.16E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 1.77E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 9.70E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 5.41E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 6.95E-06 6.94E-06 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 2.25E-06 mr1730 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 7.36E-06 7.36E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 9.87E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 3.26E-06 3.26E-06 mr1866 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 4.30E-07 2.40E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 4.28E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 3.30E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 8.95E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 6.58E-07 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 3.10E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 NA 1.54E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 6.80E-06 NA mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446 2.72E-07 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251