Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406862446:

Variant ID: vg0406862446 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6862446
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGGGATCCAGCGGTGATTCGCCAAGTGTATGATTGGAGGCGGAAGACTGAGGTTGTTGCTCCCTGGTGGGATGAGGATCCGCGCCCTCTTCACCACTC[C/T]
GCCACGAATCCGCGGTTTTGGACTCTCTTTCAACAAGACTTTTATGAGTCAGTGATCAAGTCCAAAGCTCATCCCACCGTTCCCATGCAATGGATCAACT

Reverse complement sequence

AGTTGATCCATTGCATGGGAACGGTGGGATGAGCTTTGGACTTGATCACTGACTCATAAAAGTCTTGTTGAAAGAGAGTCCAAAACCGCGGATTCGTGGC[G/A]
GAGTGGTGAAGAGGGCGCGGATCCTCATCCCACCAGGGAGCAACAACCTCAGTCTTCCGCCTCCAATCATACACTTGGCGAATCACCGCTGGATCCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.90%	42.10%	0.51%	11.43%	NA
All Indica	2759	22.10%	61.60%	0.76%	15.51%	NA
All Japonica	1512	95.60%	3.90%	0.07%	0.46%	NA
Aus	269	1.50%	72.10%	0.37%	26.02%	NA
Indica I	595	7.70%	75.50%	0.84%	15.97%	NA
Indica II	465	21.50%	63.70%	1.08%	13.76%	NA
Indica III	913	27.90%	55.40%	0.33%	16.32%	NA
Indica Intermediate	786	26.70%	57.00%	1.02%	15.27%	NA
Temperate Japonica	767	96.90%	3.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.80%	3.60%	0.20%	0.40%	NA
Japonica Intermediate	241	90.90%	7.50%	0.00%	1.66%	NA
VI/Aromatic	96	55.20%	16.70%	0.00%	28.12%	NA
Intermediate	90	64.40%	25.60%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406862446	C -> DEL	LOC_Os04g12420.1	N	frameshift_variant	Average:41.079; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N
vg0406862446	C -> T	LOC_Os04g12420.1	synonymous_variant ; p.Ser622Ser; LOW	synonymous_codon	Average:41.079; most accessible tissue: Zhenshan97 young leaf, score: 72.747	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406862446	NA	1.75E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	1.64E-06	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	2.24E-09	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	2.56E-07	7.79E-08	mr1071	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	3.70E-08	NA	mr1100	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	5.21E-07	1.15E-08	mr1100	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	3.02E-08	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	4.16E-06	7.70E-07	mr1140	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	2.82E-08	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	1.24E-07	6.30E-08	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	8.39E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	1.20E-08	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	8.84E-08	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	1.98E-06	1.57E-07	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	7.22E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	4.79E-06	4.79E-06	mr1468	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	2.62E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	1.98E-10	NA	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	3.97E-06	9.33E-08	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	9.84E-09	NA	mr1618	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	9.61E-07	1.16E-07	mr1618	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	6.97E-06	NA	mr1619	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	3.41E-06	mr1622	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	7.69E-15	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	5.60E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	6.93E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	9.16E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	1.77E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	9.70E-06	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	5.41E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	6.95E-06	6.94E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	2.25E-06	mr1730	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	7.36E-06	7.36E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	9.87E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	3.26E-06	3.26E-06	mr1866	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	4.30E-07	2.40E-19	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	4.28E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	3.30E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	8.95E-06	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	6.58E-07	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	3.10E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	NA	1.54E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	6.80E-06	NA	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862446	2.72E-07	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251