\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406862378:

Variant ID: vg0406862378 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6862378
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCAACTGCAAACGCCGCCGCATCAACCCAATGTCCCCATTGGTCCTCTCCGCATTCATACCCCCGAGAGGGATCCAGCGGTGATTCGCCAAGTGTAT[G/A]
ATTGGAGGCGGAAGACTGAGGTTGTTGCTCCCTGGTGGGATGAGGATCCGCGCCCTCTTCACCACTCCGCCACGAATCCGCGGTTTTGGACTCTCTTTCA

Reverse complement sequence

TGAAAGAGAGTCCAAAACCGCGGATTCGTGGCGGAGTGGTGAAGAGGGCGCGGATCCTCATCCCACCAGGGAGCAACAACCTCAGTCTTCCGCCTCCAAT[C/T]
ATACACTTGGCGAATCACCGCTGGATCCCTCTCGGGGGTATGAATGCGGAGAGGACCAATGGGGACATTGGGTTGATGCGGCGGCGTTTGCAGTTGACGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 38.50% 0.53% 11.45% NA
All Indica  2759 26.00% 57.60% 0.87% 15.55% NA
All Japonica  1512 99.30% 0.30% 0.00% 0.40% NA
Aus  269 3.00% 70.60% 0.00% 26.39% NA
Indica I  595 8.90% 74.80% 0.67% 15.63% NA
Indica II  465 21.50% 63.00% 1.72% 13.76% NA
Indica III  913 38.10% 45.00% 0.44% 16.43% NA
Indica Intermediate  786 27.60% 55.90% 1.02% 15.52% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 99.20% 0.40% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 0.40% 0.00% 1.24% NA
VI/Aromatic  96 55.20% 16.70% 0.00% 28.12% NA
Intermediate  90 64.40% 25.60% 1.11% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406862378 G -> DEL LOC_Os04g12420.1 N frameshift_variant Average:41.059; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg0406862378 G -> A LOC_Os04g12420.1 missense_variant ; p.Asp600Asn; MODERATE nonsynonymous_codon ; D600N Average:41.059; most accessible tissue: Zhenshan97 young leaf, score: 76.099 unknown unknown TOLERATED 0.60

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406862378 NA 1.60E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 5.62E-07 5.62E-07 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 3.61E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.96E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 5.35E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 9.40E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 6.59E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.44E-07 8.44E-07 mr1187 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 1.30E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 1.71E-12 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 9.15E-06 NA mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 1.32E-07 1.32E-07 mr1270 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 8.57E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 6.87E-07 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 2.03E-06 2.03E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 7.00E-06 7.00E-06 mr1293 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 5.97E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.84E-06 8.83E-06 mr1299 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 3.34E-06 mr1314 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 7.09E-06 2.40E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 1.19E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.63E-06 NA mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 4.83E-06 4.82E-06 mr1353 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.62E-06 NA mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 4.54E-06 4.73E-07 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 1.22E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 1.52E-06 1.52E-06 mr1393 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 5.53E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 3.10E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 7.49E-06 7.49E-06 mr1417 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 5.22E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 9.24E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 2.91E-06 NA mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 6.11E-06 1.01E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.37E-06 8.37E-06 mr1474 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.37E-06 8.37E-06 mr1475 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 2.86E-06 2.85E-06 mr1485 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 6.07E-06 mr1500 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 1.57E-06 NA mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 2.80E-07 2.80E-07 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 6.79E-08 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 1.00E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 7.02E-06 7.02E-06 mr1545 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.40E-09 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 3.18E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.80E-07 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 9.03E-07 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 5.76E-06 4.62E-07 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 4.57E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 5.28E-06 1.13E-07 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 1.79E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 4.41E-06 3.94E-07 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 5.83E-06 4.42E-07 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 9.32E-06 9.32E-06 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.89E-06 8.89E-06 mr1700 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 8.32E-07 NA mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 3.19E-07 3.19E-07 mr1724 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 4.19E-06 NA mr1774 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 6.64E-07 6.64E-07 mr1774 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 2.92E-06 NA mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 3.14E-08 3.14E-08 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 6.61E-07 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.67E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 3.08E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 4.80E-06 4.80E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.28E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.76E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406862378 NA 2.62E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251