\
| Variant ID: vg0406860650 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6860650 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, G: 0.45, others allele: 0.00, population size: 93. )
CAAAACTCTGTCGCCCTATCCACCGCCGAAGCGGAATATGTTTCGGCGGGGAGTTGTTGTGCTCAACTTCTTTGGATGAAGCAAACCCTGAGAGACTATG[A/G]
CCTCAATGTATCTACAATCCCACTCCTATGTGACAATGAGTGCGCCACTAAGATAGCCAACAACCCCGTCCAACACTCCCGAACCAAACATATCGATATT
AATATCGATATGTTTGGTTCGGGAGTGTTGGACGGGGTTGTTGGCTATCTTAGTGGCGCACTCATTGTCACATAGGAGTGGGATTGTAGATACATTGAGG[T/C]
CATAGTCTCTCAGGGTTTGCTTCATCCAAAGAAGTTGAGCACAACAACTCCCCGCCGAAACATATTCCGCTTCGGCGGTGGATAGGGCGACAGAGTTTTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.40% | 43.70% | 0.42% | 11.45% | NA |
| All Indica | 2759 | 21.10% | 62.70% | 0.62% | 15.55% | NA |
| All Japonica | 1512 | 95.40% | 4.00% | 0.07% | 0.46% | NA |
| Aus | 269 | 0.70% | 72.50% | 0.37% | 26.39% | NA |
| Indica I | 595 | 7.90% | 75.30% | 1.34% | 15.46% | NA |
| Indica II | 465 | 21.30% | 64.30% | 0.65% | 13.76% | NA |
| Indica III | 913 | 25.60% | 57.80% | 0.33% | 16.21% | NA |
| Indica Intermediate | 786 | 25.70% | 58.00% | 0.38% | 15.90% | NA |
| Temperate Japonica | 767 | 96.90% | 3.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.80% | 3.60% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 90.00% | 8.30% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 20.80% | 52.10% | 0.00% | 27.08% | NA |
| Intermediate | 90 | 56.70% | 33.30% | 1.11% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406860650 | A -> DEL | N | N | silent_mutation | Average:27.423; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg0406860650 | A -> G | LOC_Os04g12420.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.423; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406860650 | NA | 5.19E-14 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 1.21E-11 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 3.83E-08 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | 5.74E-06 | 5.74E-06 | mr1353 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | 9.50E-06 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | 5.60E-06 | NA | mr1618 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 1.13E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 4.31E-06 | mr1730 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | 2.71E-06 | 2.71E-06 | mr1866 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 3.92E-19 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 3.10E-11 | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 1.28E-06 | mr1949 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406860650 | NA | 1.40E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |