Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406858792:

Variant ID: vg0406858792 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6858792
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GATGGCGAGGACCATGTTGGATGAGTACAAGACATCGGACCGTTTTTGGGCCGAAGCCGTCAACACCGCATGCCACGCCATCAACCGCCTTTATCTTCAC[T/C]
ACCATCTTAAGAGGACTCCCTATGAGCTTCTTACCGGTAACAAACCAAATGTCTCTTACTTTCATGTTTTCGGTAGTAAGTGTTACATTCTTAATAAGAA

Reverse complement sequence

TTCTTATTAAGAATGTAACACTTACTACCGAAAACATGAAAGTAAGAGACATTTGGTTTGTTACCGGTAAGAAGCTCATAGGGAGTCCTCTTAAGATGGT[A/G]
GTGAAGATAAAGGCGGTTGATGGCGTGGCATGCGGTGTTGACGGCTTCGGCCCAAAAACGGTCCGATGTCTTGTACTCATCCAACATGGTCCTCGCCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	30.70%	9.48%	2.16%	NA
All Indica	2759	44.10%	40.10%	12.54%	3.26%	NA
All Japonica	1512	94.60%	4.90%	0.40%	0.07%	NA
Aus	269	1.50%	72.10%	25.28%	1.12%	NA
Indica I	595	75.00%	8.70%	13.61%	2.69%	NA
Indica II	465	25.40%	60.60%	3.87%	10.11%	NA
Indica III	913	35.70%	47.60%	15.55%	1.10%	NA
Indica Intermediate	786	41.70%	42.70%	13.36%	2.16%	NA
Temperate Japonica	767	96.00%	3.90%	0.13%	0.00%	NA
Tropical Japonica	504	94.80%	4.80%	0.40%	0.00%	NA
Japonica Intermediate	241	90.00%	8.30%	1.24%	0.41%	NA
VI/Aromatic	96	20.80%	50.00%	21.88%	7.29%	NA
Intermediate	90	57.80%	33.30%	7.78%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406858792	T -> C	LOC_Os04g12420.1	missense_variant ; p.Tyr154His; MODERATE	nonsynonymous_codon ; Y154R	Average:22.844; most accessible tissue: Minghui63 young leaf, score: 49.581	benign	-0.343	TOLERATED	0.95
vg0406858792	T -> C	LOC_Os04g12420.1	missense_variant ; p.Tyr154His; MODERATE	nonsynonymous_codon ; Y154H	Average:22.844; most accessible tissue: Minghui63 young leaf, score: 49.581	benign	0.127	TOLERATED	0.14
vg0406858792	T -> DEL	LOC_Os04g12420.1	N	frameshift_variant	Average:22.844; most accessible tissue: Minghui63 young leaf, score: 49.581	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406858792	NA	1.48E-07	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.43E-06	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	2.97E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	2.38E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	3.56E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	6.42E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	3.60E-06	3.60E-06	mr1573	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	2.30E-10	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	8.90E-07	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	4.40E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.51E-07	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.52E-12	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.17E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	3.43E-13	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	5.17E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	4.29E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	3.34E-07	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	8.51E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	2.44E-07	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	2.65E-10	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	9.19E-06	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	5.80E-07	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.20E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.31E-20	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	1.12E-13	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	3.29E-08	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792	NA	4.10E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251