\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406858792:

Variant ID: vg0406858792 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6858792
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGCGAGGACCATGTTGGATGAGTACAAGACATCGGACCGTTTTTGGGCCGAAGCCGTCAACACCGCATGCCACGCCATCAACCGCCTTTATCTTCAC[T/C]
ACCATCTTAAGAGGACTCCCTATGAGCTTCTTACCGGTAACAAACCAAATGTCTCTTACTTTCATGTTTTCGGTAGTAAGTGTTACATTCTTAATAAGAA

Reverse complement sequence

TTCTTATTAAGAATGTAACACTTACTACCGAAAACATGAAAGTAAGAGACATTTGGTTTGTTACCGGTAAGAAGCTCATAGGGAGTCCTCTTAAGATGGT[A/G]
GTGAAGATAAAGGCGGTTGATGGCGTGGCATGCGGTGTTGACGGCTTCGGCCCAAAAACGGTCCGATGTCTTGTACTCATCCAACATGGTCCTCGCCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 30.70% 9.48% 2.16% NA
All Indica  2759 44.10% 40.10% 12.54% 3.26% NA
All Japonica  1512 94.60% 4.90% 0.40% 0.07% NA
Aus  269 1.50% 72.10% 25.28% 1.12% NA
Indica I  595 75.00% 8.70% 13.61% 2.69% NA
Indica II  465 25.40% 60.60% 3.87% 10.11% NA
Indica III  913 35.70% 47.60% 15.55% 1.10% NA
Indica Intermediate  786 41.70% 42.70% 13.36% 2.16% NA
Temperate Japonica  767 96.00% 3.90% 0.13% 0.00% NA
Tropical Japonica  504 94.80% 4.80% 0.40% 0.00% NA
Japonica Intermediate  241 90.00% 8.30% 1.24% 0.41% NA
VI/Aromatic  96 20.80% 50.00% 21.88% 7.29% NA
Intermediate  90 57.80% 33.30% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406858792 T -> C LOC_Os04g12420.1 missense_variant ; p.Tyr154His; MODERATE nonsynonymous_codon ; Y154R Average:22.844; most accessible tissue: Minghui63 young leaf, score: 49.581 benign -0.343 TOLERATED 0.95
vg0406858792 T -> C LOC_Os04g12420.1 missense_variant ; p.Tyr154His; MODERATE nonsynonymous_codon ; Y154H Average:22.844; most accessible tissue: Minghui63 young leaf, score: 49.581 benign 0.127 TOLERATED 0.14
vg0406858792 T -> DEL LOC_Os04g12420.1 N frameshift_variant Average:22.844; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406858792 NA 1.48E-07 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.43E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 2.97E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 2.38E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 3.56E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 6.42E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 3.60E-06 3.60E-06 mr1573 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 2.30E-10 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 8.90E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 4.40E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.51E-07 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.52E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.17E-07 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 3.43E-13 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 5.17E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 4.29E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 3.34E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 8.51E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 2.44E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 2.65E-10 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 9.19E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 5.80E-07 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.20E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.31E-20 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 1.12E-13 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 3.29E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406858792 NA 4.10E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251