Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406854973:

Variant ID: vg0406854973 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6854973
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

GGCCCAAGGGGCAAGAATATTTCTATCAAGAGAGTACTTTGGGTGCCTAACGCACTTGTTACTAACATGGGAGGACCCAAGCAAGTATGGGTACCTAAAA[C/T]
TAGAAATTGATCTCTTGTAGGAATATGTCTCCGGTGGAAGAAGTTGGGTGATTGATAGTGGATGCACCAATCACATGACCGGAGAAGAATCAATGTTTTC

Reverse complement sequence

GAAAACATTGATTCTTCTCCGGTCATGTGATTGGTGCATCCACTATCAATCACCCAACTTCTTCCACCGGAGACATATTCCTACAAGAGATCAATTTCTA[G/A]
TTTTAGGTACCCATACTTGCTTGGGTCCTCCCATGTTAGTAACAAGTGCGTTAGGCACCCAAAGTACTCTCTTGATAGAAATATTCTTGCCCCTTGGGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	37.70%	2.92%	8.84%	NA
All Indica	2759	27.60%	56.30%	4.20%	11.92%	NA
All Japonica	1512	99.30%	0.30%	0.00%	0.46%	NA
Aus	269	4.80%	69.90%	1.86%	23.42%	NA
Indica I	595	8.40%	74.60%	4.03%	12.94%	NA
Indica II	465	27.10%	58.70%	2.80%	11.40%	NA
Indica III	913	38.80%	44.70%	4.05%	12.49%	NA
Indica Intermediate	786	29.50%	54.30%	5.34%	10.81%	NA
Temperate Japonica	767	99.70%	0.10%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.40%	0.00%	0.40%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	56.20%	14.60%	16.67%	12.50%	NA
Intermediate	90	64.40%	26.70%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406854973	C -> DEL	N	N	silent_mutation	Average:17.444; most accessible tissue: Callus, score: 30.311	N	N	N	N
vg0406854973	C -> T	LOC_Os04g12420.1	upstream_gene_variant ; 3360.0bp to feature; MODIFIER	silent_mutation	Average:17.444; most accessible tissue: Callus, score: 30.311	N	N	N	N
vg0406854973	C -> T	LOC_Os04g12410.1	downstream_gene_variant ; 669.0bp to feature; MODIFIER	silent_mutation	Average:17.444; most accessible tissue: Callus, score: 30.311	N	N	N	N
vg0406854973	C -> T	LOC_Os04g12410-LOC_Os04g12420	intergenic_region ; MODIFIER	silent_mutation	Average:17.444; most accessible tissue: Callus, score: 30.311	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406854973	NA	3.65E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	3.61E-06	6.01E-07	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	3.86E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	3.69E-06	NA	mr1081	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	1.23E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	2.21E-13	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	7.50E-06	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	5.30E-06	NA	mr1256	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	4.28E-06	4.28E-06	mr1270	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	4.26E-06	NA	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	4.98E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	3.77E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	8.52E-06	NA	mr1314	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	7.34E-07	5.33E-07	mr1314	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	8.05E-06	NA	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	1.35E-06	mr1387	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	2.83E-06	2.83E-06	mr1393	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	4.77E-06	mr1395	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	3.36E-06	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	7.59E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	4.77E-11	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	8.79E-07	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	3.02E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	2.21E-14	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	4.25E-06	1.11E-06	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	7.68E-07	7.68E-07	mr1643	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	1.09E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	1.35E-06	1.35E-06	mr1661	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	6.69E-06	4.23E-06	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	4.32E-06	NA	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	5.62E-06	5.62E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	4.45E-06	NA	mr1724	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	7.51E-06	7.51E-06	mr1724	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	8.11E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	8.85E-06	8.85E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	1.32E-06	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406854973	NA	8.25E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251