\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406853125:

Variant ID: vg0406853125 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6853125
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAAAAAGGCTATGTTTTGCAGAATCCCGAAGATCCCACCAAGGAGGACGACGAGAACGAGCACAAGAACGCTCAAGCCGCTAATGCAATACTTAGCGC[C/G]
TTGAGTGAAAGTGAGTTCAACTGTGTGGATGGCATTGAGAGTGCCAAAGTGATTTGGGACACGCTTCAGAACTTGCATGAAGGCACGAATAGTGTTCGTG

Reverse complement sequence

CACGAACACTATTCGTGCCTTCATGCAAGTTCTGAAGCGTGTCCCAAATCACTTTGGCACTCTCAATGCCATCCACACAGTTGAACTCACTTTCACTCAA[G/C]
GCGCTAAGTATTGCATTAGCGGCTTGAGCGTTCTTGTGCTCGTTCTCGTCGTCCTCCTTGGTGGGATCTTCGGGATTCTGCAAAACATAGCCTTTTTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 10.90% 3.51% 11.45% NA
All Indica  2759 62.50% 18.10% 5.69% 13.77% NA
All Japonica  1512 95.60% 0.30% 0.07% 3.97% NA
Aus  269 71.70% 0.00% 0.74% 27.51% NA
Indica I  595 77.00% 6.10% 2.52% 14.45% NA
Indica II  465 70.50% 15.30% 1.51% 12.69% NA
Indica III  913 49.70% 23.70% 11.50% 15.12% NA
Indica Intermediate  786 61.50% 22.40% 3.82% 12.34% NA
Temperate Japonica  767 97.00% 0.10% 0.00% 2.87% NA
Tropical Japonica  504 95.20% 0.80% 0.00% 3.97% NA
Japonica Intermediate  241 92.10% 0.00% 0.41% 7.47% NA
VI/Aromatic  96 74.00% 0.00% 5.21% 20.83% NA
Intermediate  90 81.10% 10.00% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406853125 C -> DEL LOC_Os04g12410.1 N frameshift_variant Average:30.113; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0406853125 C -> G LOC_Os04g12410.1 synonymous_variant ; p.Ala99Ala; LOW synonymous_codon Average:30.113; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0406853125 C -> G LOC_Os04g12410.1 synonymous_variant ; p.Ala99Ala; LOW nonsynonymous_codon ; A99T Average:30.113; most accessible tissue: Minghui63 flag leaf, score: 57.188 possibly damaging 1.571 DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406853125 NA 5.87E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 7.55E-06 7.55E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 1.08E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 4.02E-09 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 7.94E-06 3.90E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 7.90E-06 7.90E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 4.68E-08 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 7.17E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 6.13E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 2.84E-06 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 4.62E-08 4.43E-08 mr1687 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 2.83E-08 2.83E-08 mr1687 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 NA 1.01E-06 mr1765 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406853125 4.92E-06 4.92E-06 mr1866 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251