\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406850673:

Variant ID: vg0406850673 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6850673
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.08, A: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CGATGAAACCTTCATAACCACCATTGGGGAGTCATCAAGAGCATACACGTGGAAGCAGATGGTGAGAGGAGCCAAGGTCCGTTCGAGCGACCTTATAGTT[C/T]
GGCCGACCTTTTGGCCCACCTCTCGGCCTCTCCTTCGGCAGTGAGGTTGCCTGGTGGCCCCCCCTACATGTTATACCTTGGTTAGGCTCAATTGTAGGTA

Reverse complement sequence

TACCTACAATTGAGCCTAACCAAGGTATAACATGTAGGGGGGGCCACCAGGCAACCTCACTGCCGAAGGAGAGGCCGAGAGGTGGGCCAAAAGGTCGGCC[G/A]
AACTATAAGGTCGCTCGAACGGACCTTGGCTCCTCTCACCATCTGCTTCCACGTGTATGCTCTTGATGACTCCCCAATGGTGGTTATGAAGGTTTCATCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 38.10% 0.44% 11.62% NA
All Indica  2759 76.40% 7.20% 0.62% 15.77% NA
All Japonica  1512 0.70% 98.90% 0.00% 0.46% NA
Aus  269 70.60% 2.20% 0.37% 26.77% NA
Indica I  595 81.50% 0.80% 1.01% 16.64% NA
Indica II  465 79.80% 5.80% 0.22% 14.19% NA
Indica III  913 69.30% 13.90% 0.88% 15.88% NA
Indica Intermediate  786 78.90% 5.00% 0.25% 15.90% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 1.20% 98.40% 0.00% 0.40% NA
Japonica Intermediate  241 0.40% 97.90% 0.00% 1.66% NA
VI/Aromatic  96 15.60% 55.20% 1.04% 28.12% NA
Intermediate  90 36.70% 52.20% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406850673 C -> DEL N N silent_mutation Average:26.849; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0406850673 C -> T LOC_Os04g12400.1 upstream_gene_variant ; 2342.0bp to feature; MODIFIER silent_mutation Average:26.849; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0406850673 C -> T LOC_Os04g12410.1 upstream_gene_variant ; 2156.0bp to feature; MODIFIER silent_mutation Average:26.849; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N
vg0406850673 C -> T LOC_Os04g12400-LOC_Os04g12410 intergenic_region ; MODIFIER silent_mutation Average:26.849; most accessible tissue: Minghui63 young leaf, score: 57.221 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406850673 NA 1.30E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 8.98E-06 2.87E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 2.80E-06 4.41E-08 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 1.22E-06 1.95E-07 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 9.26E-06 1.14E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 1.03E-06 2.93E-07 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 1.57E-35 mr1402 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 2.04E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 1.91E-76 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 4.38E-06 6.63E-07 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 1.54E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 2.10E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 4.32E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406850673 NA 5.74E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251