\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406849851:

Variant ID: vg0406849851 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6849851
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TCGATAAAAGATCATATATTAGCCCGGCTTTTGAAAGAAAGCCCAAACCAAACAGAGTATTCCAGGGTATCAAATATAAGGAACGTGCATATACTTTTTA[T/C]
GAACAGGATTCTATCAAAGGACAACATGACGAGTGATAGGCTAGAGAGGATTCCTATGGACGTATTTAGCTGACTTAAGTTAAAGGCAAAACTTTATCGA

Reverse complement sequence

TCGATAAAGTTTTGCCTTTAACTTAAGTCAGCTAAATACGTCCATAGGAATCCTCTCTAGCCTATCACTCGTCATGTTGTCCTTTGATAGAATCCTGTTC[A/G]
TAAAAAGTATATGCACGTTCCTTATATTTGATACCCTGGAATACTCTGTTTGGTTTGGGCTTTCTTTCAAAAGCCGGGCTAATATATGATCTTTTATCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 43.90% 0.49% 11.60% NA
All Indica  2759 62.80% 20.70% 0.69% 15.73% NA
All Japonica  1512 4.50% 94.90% 0.13% 0.46% NA
Aus  269 72.50% 0.40% 0.74% 26.39% NA
Indica I  595 75.30% 7.40% 0.17% 17.14% NA
Indica II  465 64.70% 20.20% 0.65% 14.41% NA
Indica III  913 57.90% 25.20% 0.88% 15.99% NA
Indica Intermediate  786 58.00% 26.00% 0.89% 15.14% NA
Temperate Japonica  767 3.70% 96.00% 0.26% 0.13% NA
Tropical Japonica  504 4.00% 95.60% 0.00% 0.40% NA
Japonica Intermediate  241 8.30% 90.00% 0.00% 1.66% NA
VI/Aromatic  96 52.10% 18.80% 0.00% 29.17% NA
Intermediate  90 35.60% 55.60% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406849851 T -> C LOC_Os04g12400.1 upstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:32.873; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0406849851 T -> C LOC_Os04g12410.1 upstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:32.873; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0406849851 T -> C LOC_Os04g12400-LOC_Os04g12410 intergenic_region ; MODIFIER silent_mutation Average:32.873; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0406849851 T -> DEL N N silent_mutation Average:32.873; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406849851 NA 4.67E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 6.50E-06 6.50E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 9.28E-07 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.97E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 4.91E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 7.37E-06 mr1189 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 1.84E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 1.59E-07 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 4.88E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 9.49E-06 9.49E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 4.57E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 8.97E-06 mr1314 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 9.34E-06 NA mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 9.65E-08 1.24E-07 mr1320 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 4.17E-06 4.17E-06 mr1353 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 3.61E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.38E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 6.34E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 1.75E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.51E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 3.14E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.30E-10 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 6.33E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 8.90E-07 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 3.66E-06 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 4.49E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 1.30E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 9.45E-06 9.45E-06 mr1643 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 4.60E-06 1.57E-06 mr1660 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 7.74E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.92E-06 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 3.84E-06 3.84E-06 mr1866 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.68E-20 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 3.43E-13 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 5.53E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 5.17E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 4.29E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 3.34E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 8.51E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 9.36E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.44E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 2.65E-10 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 9.19E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 5.80E-07 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 3.29E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406849851 NA 4.10E-07 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251