Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406837723:

Variant ID: vg0406837723 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6837723
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TCATAGCATTATAACAGATTAACAGTACTAGAATGATTATTTGTTTTATTTCTGCCGCTTGTTTGTTTTTGTTGTATACATTGAAATTAAAATTAAGCGA[T/C]
AACCATTCACCCCCTTCTGATCAAGGCAACCTCGCTACAAGTGCCATGCGTACATCAAGCCGCTCCTCCAAAGAGTAGTCCAAAGAGTAGAGTATATATA

Reverse complement sequence

TATATATACTCTACTCTTTGGACTACTCTTTGGAGGAGCGGCTTGATGTACGCATGGCACTTGTAGCGAGGTTGCCTTGATCAGAAGGGGGTGAATGGTT[A/G]
TCGCTTAATTTTAATTTCAATGTATACAACAAAAACAAACAAGCGGCAGAAATAAAACAAATAATCATTCTAGTACTGTTAATCTGTTATAATGCTATGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	24.50%	0.51%	8.10%	NA
All Indica	2759	46.40%	41.70%	0.76%	11.09%	NA
All Japonica	1512	99.70%	0.00%	0.07%	0.26%	NA
Aus	269	82.20%	0.40%	0.37%	17.10%	NA
Indica I	595	21.50%	68.90%	1.01%	8.57%	NA
Indica II	465	65.60%	24.90%	0.43%	9.03%	NA
Indica III	913	49.00%	35.60%	0.66%	14.79%	NA
Indica Intermediate	786	51.00%	38.20%	0.89%	9.92%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	77.10%	0.00%	0.00%	22.92%	NA
Intermediate	90	85.60%	7.80%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406837723	T -> C	LOC_Os04g12390.1	intron_variant ; MODIFIER	silent_mutation	Average:32.81; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0406837723	T -> DEL	N	N	silent_mutation	Average:32.81; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406837723	NA	3.52E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	8.30E-08	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	8.32E-06	mr1100	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	1.14E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	2.34E-06	3.05E-17	mr1199	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	1.03E-06	mr1199	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	5.98E-07	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	1.35E-06	mr1382	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	7.78E-06	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	5.15E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	6.81E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	8.71E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	2.54E-06	2.54E-06	mr1612	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	1.14E-06	mr1622	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	3.44E-07	mr1696	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	1.50E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	6.85E-06	7.27E-10	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	4.64E-09	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	9.74E-06	mr1895	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	2.34E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	2.03E-06	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	3.04E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	7.72E-11	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	1.55E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723	NA	2.94E-15	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251