\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406837723:

Variant ID: vg0406837723 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6837723
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TCATAGCATTATAACAGATTAACAGTACTAGAATGATTATTTGTTTTATTTCTGCCGCTTGTTTGTTTTTGTTGTATACATTGAAATTAAAATTAAGCGA[T/C]
AACCATTCACCCCCTTCTGATCAAGGCAACCTCGCTACAAGTGCCATGCGTACATCAAGCCGCTCCTCCAAAGAGTAGTCCAAAGAGTAGAGTATATATA

Reverse complement sequence

TATATATACTCTACTCTTTGGACTACTCTTTGGAGGAGCGGCTTGATGTACGCATGGCACTTGTAGCGAGGTTGCCTTGATCAGAAGGGGGTGAATGGTT[A/G]
TCGCTTAATTTTAATTTCAATGTATACAACAAAAACAAACAAGCGGCAGAAATAAAACAAATAATCATTCTAGTACTGTTAATCTGTTATAATGCTATGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 24.50% 0.51% 8.10% NA
All Indica  2759 46.40% 41.70% 0.76% 11.09% NA
All Japonica  1512 99.70% 0.00% 0.07% 0.26% NA
Aus  269 82.20% 0.40% 0.37% 17.10% NA
Indica I  595 21.50% 68.90% 1.01% 8.57% NA
Indica II  465 65.60% 24.90% 0.43% 9.03% NA
Indica III  913 49.00% 35.60% 0.66% 14.79% NA
Indica Intermediate  786 51.00% 38.20% 0.89% 9.92% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 77.10% 0.00% 0.00% 22.92% NA
Intermediate  90 85.60% 7.80% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406837723 T -> C LOC_Os04g12390.1 intron_variant ; MODIFIER silent_mutation Average:32.81; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0406837723 T -> DEL N N silent_mutation Average:32.81; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406837723 NA 3.52E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 8.30E-08 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 8.32E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 1.14E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 2.34E-06 3.05E-17 mr1199 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 1.03E-06 mr1199 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 5.98E-07 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 1.35E-06 mr1382 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 7.78E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 5.15E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 6.81E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 8.71E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 2.54E-06 2.54E-06 mr1612 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 1.14E-06 mr1622 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 3.44E-07 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 1.50E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 6.85E-06 7.27E-10 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 4.64E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 9.74E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 2.34E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 2.03E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 3.04E-09 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 7.72E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 1.55E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406837723 NA 2.94E-15 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251