\
| Variant ID: vg0406835352 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6835352 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 89. )
TATTTATTATTTCCTTTAAAATATAAAATTACAATTCTATAGACCTAATATTACATTTGTAAGTTAAGTTGATATGACATGTAAGTGTATTGTAATTTCA[C/T]
TATAGTTATACTGTAATTACAATGTAACTATAATAGAATTACACTGTAACTTTTAGTGTAATTGCAGTGTAACTATAGTGAAATTTATCTTCTATGCATT
AATGCATAGAAGATAAATTTCACTATAGTTACACTGCAATTACACTAAAAGTTACAGTGTAATTCTATTATAGTTACATTGTAATTACAGTATAACTATA[G/A]
TGAAATTACAATACACTTACATGTCATATCAACTTAACTTACAAATGTAATATTAGGTCTATAGAATTGTAATTTTATATTTTAAAGGAAATAATAAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 12.80% | 0.32% | 8.40% | NA |
| All Indica | 2759 | 68.10% | 19.80% | 0.40% | 11.71% | NA |
| All Japonica | 1512 | 99.20% | 0.50% | 0.07% | 0.26% | NA |
| Aus | 269 | 82.90% | 0.40% | 0.74% | 15.99% | NA |
| Indica I | 595 | 85.20% | 6.10% | 0.00% | 8.74% | NA |
| Indica II | 465 | 71.80% | 15.70% | 0.86% | 11.61% | NA |
| Indica III | 913 | 57.30% | 27.80% | 0.55% | 14.35% | NA |
| Indica Intermediate | 786 | 65.60% | 23.20% | 0.25% | 10.94% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.80% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 40.60% | 35.40% | 1.04% | 22.92% | NA |
| Intermediate | 90 | 75.60% | 18.90% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406835352 | C -> DEL | N | N | silent_mutation | Average:28.957; most accessible tissue: Callus, score: 62.597 | N | N | N | N |
| vg0406835352 | C -> T | LOC_Os04g12390.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.957; most accessible tissue: Callus, score: 62.597 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406835352 | NA | 6.31E-07 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 6.65E-06 | mr1233 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 6.62E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 8.07E-06 | mr1314 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 3.71E-07 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 9.54E-06 | mr1426 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 6.73E-07 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | 3.08E-06 | NA | mr1537 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 3.21E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 6.71E-06 | mr1574 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406835352 | NA | 5.32E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |