\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406833198:

Variant ID: vg0406833198 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6833198
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


GGGACTAAAGATCATTTTTAGTCCCGGTTCAAGAAGTTGAGGGGTTCAAGACAGACCCCGATTATTTTTACTACCGGTTGGTATAAACAACCGGGACTAA[A/T]
AACAGATCTTTAGTCCCGGTTGTTTATATCAACCGGGAGTAAAGAGTACCCCGAACCGCGCGCCAGATATTATCCGTGCGCCACAAAAATAATTGTTTAT

Reverse complement sequence

ATAAACAATTATTTTTGTGGCGCACGGATAATATCTGGCGCGCGGTTCGGGGTACTCTTTACTCCCGGTTGATATAAACAACCGGGACTAAAGATCTGTT[T/A]
TTAGTCCCGGTTGTTTATACCAACCGGTAGTAAAAATAATCGGGGTCTGTCTTGAACCCCTCAACTTCTTGAACCGGGACTAAAAATGATCTTTAGTCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 14.60% 0.36% 8.70% NA
All Indica  2759 70.40% 17.00% 0.58% 12.03% NA
All Japonica  1512 99.40% 0.30% 0.07% 0.26% NA
Aus  269 11.90% 69.90% 0.00% 18.22% NA
Indica I  595 89.40% 1.20% 0.84% 8.57% NA
Indica II  465 50.10% 37.20% 0.22% 12.47% NA
Indica III  913 67.60% 16.90% 0.66% 14.90% NA
Indica Intermediate  786 71.10% 17.30% 0.51% 11.07% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.40% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 62.50% 14.60% 0.00% 22.92% NA
Intermediate  90 80.00% 15.60% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406833198 A -> DEL N N silent_mutation Average:24.271; most accessible tissue: Callus, score: 55.677 N N N N
vg0406833198 A -> T LOC_Os04g12380.1 upstream_gene_variant ; 3342.0bp to feature; MODIFIER silent_mutation Average:24.271; most accessible tissue: Callus, score: 55.677 N N N N
vg0406833198 A -> T LOC_Os04g12390.1 downstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:24.271; most accessible tissue: Callus, score: 55.677 N N N N
vg0406833198 A -> T LOC_Os04g12380-LOC_Os04g12390 intergenic_region ; MODIFIER silent_mutation Average:24.271; most accessible tissue: Callus, score: 55.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406833198 NA 4.22E-10 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 5.77E-08 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.12E-12 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.68E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.02E-10 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.14E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 4.69E-11 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.09E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 4.53E-12 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.07E-12 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 3.10E-09 1.43E-18 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.46E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 5.89E-11 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 3.51E-06 mr1113_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.54E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.83E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.03E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 4.74E-11 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 3.02E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.30E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.61E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 5.84E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 6.08E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 4.57E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 5.52E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 7.88E-20 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 3.31E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 1.70E-12 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.90E-12 mr1830_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 6.89E-22 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833198 NA 2.14E-11 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251