\
| Variant ID: vg0406792377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6792377 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCTCCCGTTTGATCCCACAAAAGCGGAGTGCGGCACTTCCGACCATACAGTGCTTCGTAAGGAGCCATCTGAAGACTAGCTTGATAACTGTTGTTGTAC[G/A]
AAAATTCAGCATAAGGTAGATTCTTATCCCAACTTCCACCGAAATCTAAAGCACAAGCCCTCAACATGTCTTCCAAAATTTGATTCACCCTTTCGGTTTG
CAAACCGAAAGGGTGAATCAAATTTTGGAAGACATGTTGAGGGCTTGTGCTTTAGATTTCGGTGGAAGTTGGGATAAGAATCTACCTTATGCTGAATTTT[C/T]
GTACAACAACAGTTATCAAGCTAGTCTTCAGATGGCTCCTTACGAAGCACTGTATGGTCGGAAGTGCCGCACTCCGCTTTTGTGGGATCAAACGGGAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.40% | 2.30% | 32.97% | 29.33% | NA |
| All Indica | 2759 | 10.90% | 0.10% | 43.71% | 45.31% | NA |
| All Japonica | 1512 | 85.10% | 6.80% | 5.56% | 2.58% | NA |
| Aus | 269 | 7.40% | 0.00% | 77.32% | 15.24% | NA |
| Indica I | 595 | 21.50% | 0.20% | 32.44% | 45.88% | NA |
| Indica II | 465 | 12.30% | 0.00% | 50.54% | 37.20% | NA |
| Indica III | 913 | 3.70% | 0.10% | 49.29% | 46.88% | NA |
| Indica Intermediate | 786 | 10.30% | 0.10% | 41.73% | 47.84% | NA |
| Temperate Japonica | 767 | 78.50% | 11.90% | 8.21% | 1.43% | NA |
| Tropical Japonica | 504 | 94.00% | 1.60% | 1.98% | 2.38% | NA |
| Japonica Intermediate | 241 | 87.10% | 1.70% | 4.56% | 6.64% | NA |
| VI/Aromatic | 96 | 26.00% | 0.00% | 37.50% | 36.46% | NA |
| Intermediate | 90 | 47.80% | 2.20% | 26.67% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406792377 | G -> DEL | LOC_Os04g12310.1 | N | frameshift_variant | Average:7.067; most accessible tissue: Minghui63 flower, score: 13.501 | N | N | N | N |
| vg0406792377 | G -> A | LOC_Os04g12310.1 | missense_variant ; p.Ser1442Leu; MODERATE | nonsynonymous_codon ; S1442L | Average:7.067; most accessible tissue: Minghui63 flower, score: 13.501 | possibly damaging |
1.62 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406792377 | 8.81E-06 | 1.81E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406792377 | 3.61E-07 | 3.41E-12 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406792377 | 4.06E-07 | 4.06E-07 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406792377 | NA | 9.22E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406792377 | 4.35E-08 | 2.31E-11 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406792377 | 2.04E-06 | NA | mr1631_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406792377 | 5.07E-06 | 7.55E-09 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |