Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406790251:

Variant ID: vg0406790251 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6790251
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:

AACCCCAGAGTTTGAGTATGCGTCAGATGGTGGCTTTTCCGAGGAGTAGGCTTCGTCCGTGCCGTCGAGGATGCATGTAGAGTGGTGTTCCCGCTGCAGT[T/C]
CAAGTCAAGGCTTAGCTCCAGTTATCCTTTATTTTTCCGTTGCATTTATGTAAGACTTTTATAATGTTTGTAAGATGTGGATCTGTATGTCAACTTTGTC

Reverse complement sequence

GACAAAGTTGACATACAGATCCACATCTTACAAACATTATAAAAGTCTTACATAAATGCAACGGAAAAATAAAGGATAACTGGAGCTAAGCCTTGACTTG[A/G]
ACTGCAGCGGGAACACCACTCTACATGCATCCTCGACGGCACGGACGAAGCCTACTCCTCGGAAAAGCCACCATCTGACGCATACTCAAACTCTGGGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.50%	12.00%	22.09%	25.48%	NA
All Indica	2759	13.60%	18.40%	37.11%	30.84%	NA
All Japonica	1512	95.20%	2.70%	0.13%	1.92%	NA
Aus	269	9.30%	2.20%	1.86%	86.62%	NA
Indica I	595	28.60%	6.40%	48.40%	16.64%	NA
Indica II	465	15.10%	14.40%	23.87%	46.67%	NA
Indica III	913	3.60%	26.20%	38.44%	31.76%	NA
Indica Intermediate	786	13.00%	21.00%	34.86%	31.17%	NA
Temperate Japonica	767	96.90%	3.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.20%	1.20%	0.40%	3.17%	NA
Japonica Intermediate	241	90.00%	5.00%	0.00%	4.98%	NA
VI/Aromatic	96	25.00%	1.00%	4.17%	69.79%	NA
Intermediate	90	54.40%	8.90%	10.00%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406790251	T -> C	LOC_Os04g12300.1	upstream_gene_variant ; 258.0bp to feature; MODIFIER	silent_mutation	Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N
vg0406790251	T -> C	LOC_Os04g12290.1	downstream_gene_variant ; 2968.0bp to feature; MODIFIER	silent_mutation	Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N
vg0406790251	T -> C	LOC_Os04g12310.1	downstream_gene_variant ; 1573.0bp to feature; MODIFIER	silent_mutation	Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N
vg0406790251	T -> C	LOC_Os04g12290-LOC_Os04g12300	intergenic_region ; MODIFIER	silent_mutation	Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N
vg0406790251	T -> DEL	N	N	silent_mutation	Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406790251	NA	7.59E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251	NA	6.90E-08	mr1015	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251	NA	1.17E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251	NA	6.39E-06	mr1320	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251	NA	3.60E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251	NA	9.69E-06	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251