\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406790251:

Variant ID: vg0406790251 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6790251
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


AACCCCAGAGTTTGAGTATGCGTCAGATGGTGGCTTTTCCGAGGAGTAGGCTTCGTCCGTGCCGTCGAGGATGCATGTAGAGTGGTGTTCCCGCTGCAGT[T/C]
CAAGTCAAGGCTTAGCTCCAGTTATCCTTTATTTTTCCGTTGCATTTATGTAAGACTTTTATAATGTTTGTAAGATGTGGATCTGTATGTCAACTTTGTC

Reverse complement sequence

GACAAAGTTGACATACAGATCCACATCTTACAAACATTATAAAAGTCTTACATAAATGCAACGGAAAAATAAAGGATAACTGGAGCTAAGCCTTGACTTG[A/G]
ACTGCAGCGGGAACACCACTCTACATGCATCCTCGACGGCACGGACGAAGCCTACTCCTCGGAAAAGCCACCATCTGACGCATACTCAAACTCTGGGGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 12.00% 22.09% 25.48% NA
All Indica  2759 13.60% 18.40% 37.11% 30.84% NA
All Japonica  1512 95.20% 2.70% 0.13% 1.92% NA
Aus  269 9.30% 2.20% 1.86% 86.62% NA
Indica I  595 28.60% 6.40% 48.40% 16.64% NA
Indica II  465 15.10% 14.40% 23.87% 46.67% NA
Indica III  913 3.60% 26.20% 38.44% 31.76% NA
Indica Intermediate  786 13.00% 21.00% 34.86% 31.17% NA
Temperate Japonica  767 96.90% 3.00% 0.00% 0.13% NA
Tropical Japonica  504 95.20% 1.20% 0.40% 3.17% NA
Japonica Intermediate  241 90.00% 5.00% 0.00% 4.98% NA
VI/Aromatic  96 25.00% 1.00% 4.17% 69.79% NA
Intermediate  90 54.40% 8.90% 10.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406790251 T -> C LOC_Os04g12300.1 upstream_gene_variant ; 258.0bp to feature; MODIFIER silent_mutation Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0406790251 T -> C LOC_Os04g12290.1 downstream_gene_variant ; 2968.0bp to feature; MODIFIER silent_mutation Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0406790251 T -> C LOC_Os04g12310.1 downstream_gene_variant ; 1573.0bp to feature; MODIFIER silent_mutation Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0406790251 T -> C LOC_Os04g12290-LOC_Os04g12300 intergenic_region ; MODIFIER silent_mutation Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N
vg0406790251 T -> DEL N N silent_mutation Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406790251 NA 7.59E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251 NA 6.90E-08 mr1015 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251 NA 1.17E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251 NA 6.39E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251 NA 3.60E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406790251 NA 9.69E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251