\
| Variant ID: vg0406790251 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6790251 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 54. )
AACCCCAGAGTTTGAGTATGCGTCAGATGGTGGCTTTTCCGAGGAGTAGGCTTCGTCCGTGCCGTCGAGGATGCATGTAGAGTGGTGTTCCCGCTGCAGT[T/C]
CAAGTCAAGGCTTAGCTCCAGTTATCCTTTATTTTTCCGTTGCATTTATGTAAGACTTTTATAATGTTTGTAAGATGTGGATCTGTATGTCAACTTTGTC
GACAAAGTTGACATACAGATCCACATCTTACAAACATTATAAAAGTCTTACATAAATGCAACGGAAAAATAAAGGATAACTGGAGCTAAGCCTTGACTTG[A/G]
ACTGCAGCGGGAACACCACTCTACATGCATCCTCGACGGCACGGACGAAGCCTACTCCTCGGAAAAGCCACCATCTGACGCATACTCAAACTCTGGGGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.50% | 12.00% | 22.09% | 25.48% | NA |
| All Indica | 2759 | 13.60% | 18.40% | 37.11% | 30.84% | NA |
| All Japonica | 1512 | 95.20% | 2.70% | 0.13% | 1.92% | NA |
| Aus | 269 | 9.30% | 2.20% | 1.86% | 86.62% | NA |
| Indica I | 595 | 28.60% | 6.40% | 48.40% | 16.64% | NA |
| Indica II | 465 | 15.10% | 14.40% | 23.87% | 46.67% | NA |
| Indica III | 913 | 3.60% | 26.20% | 38.44% | 31.76% | NA |
| Indica Intermediate | 786 | 13.00% | 21.00% | 34.86% | 31.17% | NA |
| Temperate Japonica | 767 | 96.90% | 3.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.20% | 1.20% | 0.40% | 3.17% | NA |
| Japonica Intermediate | 241 | 90.00% | 5.00% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 25.00% | 1.00% | 4.17% | 69.79% | NA |
| Intermediate | 90 | 54.40% | 8.90% | 10.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406790251 | T -> C | LOC_Os04g12300.1 | upstream_gene_variant ; 258.0bp to feature; MODIFIER | silent_mutation | Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0406790251 | T -> C | LOC_Os04g12290.1 | downstream_gene_variant ; 2968.0bp to feature; MODIFIER | silent_mutation | Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0406790251 | T -> C | LOC_Os04g12310.1 | downstream_gene_variant ; 1573.0bp to feature; MODIFIER | silent_mutation | Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0406790251 | T -> C | LOC_Os04g12290-LOC_Os04g12300 | intergenic_region ; MODIFIER | silent_mutation | Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| vg0406790251 | T -> DEL | N | N | silent_mutation | Average:45.146; most accessible tissue: Minghui63 flag leaf, score: 79.962 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406790251 | NA | 7.59E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406790251 | NA | 6.90E-08 | mr1015 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406790251 | NA | 1.17E-07 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406790251 | NA | 6.39E-06 | mr1320 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406790251 | NA | 3.60E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406790251 | NA | 9.69E-06 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |