Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406789502:

Variant ID: vg0406789502 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6789502
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCATATGGTGTGCTGTGGGTGCGTGGTTTTGCTGGTCGCGCCCATGGCTCTTAAGGACCGGTTCGCGGGATGCCCTGGAAGAACTTATCATACTTACCAC[T/A]
AGCCAGCGTGGGCAACAGCTGGGCCTGTAGTGTAGCTTTCCTCTAGCTGATGCATCCAGGCAAGGGTGGGCGTGATGGAGTTTGGATGGGCCCTACGGCG

Reverse complement sequence

CGCCGTAGGGCCCATCCAAACTCCATCACGCCCACCCTTGCCTGGATGCATCAGCTAGAGGAAAGCTACACTACAGGCCCAGCTGTTGCCCACGCTGGCT[A/T]
GTGGTAAGTATGATAAGTTCTTCCAGGGCATCCCGCGAACCGGTCCTTAAGAGCCATGGGCGCGACCAGCAAAACCACGCACCCACAGCACACCATATGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	0.00%	1.04%	34.79%	NA
All Indica	2759	48.60%	0.10%	1.59%	49.73%	NA
All Japonica	1512	98.40%	0.00%	0.00%	1.59%	NA
Aus	269	32.70%	0.00%	1.12%	66.17%	NA
Indica I	595	64.90%	0.00%	1.18%	33.95%	NA
Indica II	465	51.20%	0.20%	1.72%	46.88%	NA
Indica III	913	34.70%	0.10%	2.08%	63.09%	NA
Indica Intermediate	786	50.90%	0.00%	1.27%	47.84%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	97.60%	0.00%	0.00%	2.38%	NA
Japonica Intermediate	241	95.40%	0.00%	0.00%	4.56%	NA
VI/Aromatic	96	43.80%	0.00%	2.08%	54.17%	NA
Intermediate	90	80.00%	0.00%	0.00%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406789502	T -> DEL	N	N	silent_mutation	Average:18.538; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0406789502	T -> A	LOC_Os04g12300.1	upstream_gene_variant ; 1007.0bp to feature; MODIFIER	silent_mutation	Average:18.538; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0406789502	T -> A	LOC_Os04g12290.1	downstream_gene_variant ; 2219.0bp to feature; MODIFIER	silent_mutation	Average:18.538; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0406789502	T -> A	LOC_Os04g12310.1	downstream_gene_variant ; 2322.0bp to feature; MODIFIER	silent_mutation	Average:18.538; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N
vg0406789502	T -> A	LOC_Os04g12290-LOC_Os04g12300	intergenic_region ; MODIFIER	silent_mutation	Average:18.538; most accessible tissue: Minghui63 root, score: 35.002	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406789502	NA	6.62E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	6.70E-06	6.70E-06	mr1054	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	7.89E-06	7.89E-06	mr1331	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	8.99E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	4.01E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	5.57E-25	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	1.08E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	4.13E-06	4.13E-06	mr1651	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	2.42E-09	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	4.72E-06	4.72E-06	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	1.34E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	7.19E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	2.03E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	8.82E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	4.09E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	4.53E-09	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	4.16E-61	mr1402_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406789502	NA	3.09E-34	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251